There’s a lot of good news mixed in with the bad. Here are some positive things we’ve learned in the last week

The next emerging infectious disease could easily be more contagious, more fatal, or both.
Dr Cassidy Nelson on the twelve best ways to stop the next pandemic (and limit COVID-19)

Exploratory analyses highlight a potential additional link between COVID-19 and suicidal behavior, suggesting that a portion of individuals may be intentionally exposing themselves to the virus with intent to kill themselves. [PsyArXiv]

An article published in the Journal of Family Violence in January 2020 found that between 62 and 72 percent of women (the only gender surveyed) have been stalked, and 60 to 63 percent have experienced technology-based abuse by an intimate partner. “Technology is not the only tactic; it is one of many,” said Erica Olsen. “Today’s technology offers new ways to perpetrate abuse, but the behaviors and the reasons for it are not new. Abusers want power and control over the other person, and this is just one more way to get that.” [Here’s how to record abuse without being discovered, safeguard your devices, and, ultimately, protect yourself.]

Wuhan’s 11 million residents will be able to leave only after receiving official authorization that they are healthy and haven’t recently been in contact with a coronavirus patient. To do so, the Chinese government is making use of its mandatory smartphone application that, along with other government surveillance, tracks the movement and health status of every person. [Washington Post]

People can now leave after presenting to the authorities a government-sanctioned phone app that indicates — based on their home addresses, recent travels and medical histories — whether they are contagion risks. Footage from state-run news outlets early Wednesday showed a rush of cars traveling through toll stations on the outskirts of Wuhan immediately after the restrictions were lifted. China’s national rail operator estimated that more than 55,000 people would leave Wuhan by train on Wednesday, according to a state-run broadcaster. Officials continue to urge everyone to stay at home as much as possible. Schools are still closed. […] In recent days, more shops have reopened, often setting up street-front counters so that customers can buy vegetables, alcohol, cigarettes and other goods without entering. In parks along the Yangtze River, growing numbers of families have ventured out to take in the sunshine and fresh air. Older residents have started congregating again in small groups to chat or play rounds of Chinese chess. Children are a rarer sight, and always appear to be under the wary watch of parents. Public buses and the subway system have restarted, although they often seem to have few passengers. Mountains of cardboard boxes have sprouted up outside apartment complexes as online shopping picks up. […] Across Wuhan, nearly 94 percent of businesses — almost 11,000 of them in total — have resumed operations, said Hu Yabo, the city’s deputy mayor, at a recent news briefing. For major industrial enterprises, the rate exceeded 97 percent. For service companies, it was 93 percent. [NY Times]

And how long can democracies limit people’s freedoms to the degree we are currently experiencing? Germany hasn’t yet been completely shut down, but Italy, Spain and France have. For what length of time can the people of those countries be prohibited from going out? […] “To ensure that testing becomes quicker and more efficient,” the study reads, “the use of Big Data and location tracking is unavoidable on the long term.” If this model is followed, around a million people in Germany would become infected and only around 12,000 would die, an optimistic scenario given the current situation. It would require keeping strict measures in place for two months. But because only a small share of the population would then be immune to the virus, “extreme vigilance would have to be maintained,” the study points out. [Spiegel]

Like governments around the world, the United States is struggling with the “coronavirus trilemma”: It wants to protect lives, ease social isolation, and protect privacy and civil liberties, but it can do only two of those at the same time. In particular, and as South Korea’s successful management of the coronavirus shows, extensive surveillance may be the only way to control the outbreak while preserving some degree of normalcy for economic and social life. [Lawfare]

In the current COVID-19 pandemic, there have been official health recommendations of social distancing, thorough handwashing, and self-isolation to prevent the spread of the virus. However, compliance with these recommendations has been mixed. We suggest that non-compliance may be justified by one’s (mis)perception of their own COVID-19 risk.

Trump has a small personal financial interest in Sanofi, the French drugmaker that makes Plaquenil, the brand-name version of hydroxychloroquine.

Yale New Haven Hospital, where I work, has almost 300 people stricken with Covid-19, and the numbers keep rising — and yet we are not yet at capacity because of a marked decline in our usual types of patients. In more normal times, we never have so many empty beds. Our hospital is usually so full that patients wait in gurneys along the walls of the emergency department for a bed to become available on the general wards or even in the intensive care unit. We send people home from the hospital as soon as possible so we can free up beds for those who are waiting. But the pandemic has caused a previously unimaginable shift in the demand for hospital services. […] What is striking is that many of the emergencies have disappeared. Heart attack and stroke teams, always poised to rush in and save lives, are mostly idle. This is not just at my hospital. My fellow cardiologists have shared with me that their cardiology consultations have shrunk, except those related to Covid-19. [Harlan M. Krumholz, M.D. | NY Times]

Viruses such as SARS-CoV-2 and Influenza are lipophilic, enveloped viruses, and are relatively easy to inactivate by exposure to alcohols. […] We use 40 v/v% whisky or similar alcohol, dripping on a gauze, inhale the vapor slowly at room temperature. This method works well for the front part of the nasal cavity.[arXiv]

Coronavirus can infect cats — dogs, not so much

How Chinese Apps Handled Covid-19

More space between seats at restaurants, cinemas, sporting events and the like, meaning fewer people. Less vacation and business travel, coupled with more global government restrictions, at least until a vaccine is developed, cutting back consumer and business spending. Regulations forcing households and corporates to hold potentially three months of cash in emergency savings. A significant increase in the supply of government bonds, risking a debt crisis. […] As hard as coronavirus is going to hit the industrialized world, the impact on the developing world is going to be significantly more severe. [Axios]

A Rough Estimate of the 2020 US GDP Impact

New Research Links Air Pollution to Higher Coronavirus Death Rates (dangerous particles in air known as PM 2.5 were associated with higher death rates from the disease)

We re-analysed 640 throat swabs collected from patients in Wuhan with influenza-like-illness from 6 October 2019 to 21 January 2020 and found that 9 of the 640 throat swabs were positive for SARS-CoV-2 RNA by quantita- tive PCR, suggesting community transmission of SARS-CoV2 in Wuhan in early January 2020. [PDF | Nature Microbiology]

Fewer deaths in Veneto offer clues for fight against virus. […] Lombardy has a death rate of 17.6 per cent. Nearby Veneto’s stands at 5.6 per cent. While virologists caution that the percentage death rate is closely tied to the level of testing, they also attribute the gap to other factors, such as Veneto’s reluctance to hospitalise compared with its neighbour. […] Higher levels of testing and tracing in Veneto is the most widely cited explanation for why the region has managed to control its outbreak more effectively than its neighbours. […] Venetian doctors also cite the region’s expertise in infectious disease, something they trace back to its pioneering history dealing with viruses arriving in its port from the east. The word quarantine derives from quarantena, the Venetian word for “40 days”, or the amount of time ships arriving from plague-ridden destinations were isolated. [Financial Times]

On Friday April 3, the French Director General of Health, Jérôme Salomon, for the first time recognized that the wearing of a mask by the general public could have an interest. How did something that was deemed unnecessary for so long suddenly become useful? [France CultureGoogle Translate]

How will we know when to reopen the country? […] Hospitals in the state must be able to safely treat all patients requiring hospitalization, without resorting to crisis standards of care. A state needs to be able to test at least everyone who has symptoms. The state is able to conduct monitoring of confirmed cases and contacts. There must be a sustained reduction in cases for at least 14 days. [NY Times]

Those who are hospitalized with coronavirus can expect to pay anywhere from $42,486 to $74,310 if they are uninsured or if they receive care that’s deemed out-of-network by their insurance company. For those with insurance who are using in-network providers, out-of-pocket costs will be a portion of $21,936 to $38,755, depending on the cost-sharing provisions of their health plan. [CNBC]

The coronavirus wiped out most major tech events. But CanSecWest still took place—with face masks, temperature checks, and an eerily quiet atmosphere.

There has been a 600% increase in images of people washing their hands, face and body. The AI tool also discovered a 200% increase of “cleanliness” related images and videos. These included touching faces, sneezing, coughing, drinking, smelling, tissues and cleaning. […] 8% drop in the use of travel imagery. [AdNews]

Panama is quarantining women and men on different days during its coronavirus lockdown

Around the world, seismologists are observing a lot less ambient seismic noise — meaning, the vibrations generated by cars, trains, buses and people going about their daily lives. And in the absence of that noise, Earth’s upper crust is moving just a little less. [CNN]

What NASA is doing to keep COVID-19 off the space station

Several dogs and cats have tested positive to COVID-19 virus following close contact with infected humans. Studies are underway to better understand the susceptibility of different animal species to the COVID-19 virus and to assess infection dynamics in susceptible animal species. Currently, there is no evidence to suggest that animals infected by humans are playing a role in the spread of COVID-19. Human outbreaks are driven by person to person contact. [World Organisation for Animal Health]

A tiger at the Bronx Zoo tests positive for the coronavirus, and other big cats there appear ill.

In some regions of the country, non-coronavirus deaths were rising at an alarming rate alongside confirmed COVID-19 deaths — the total death count was up as much as sixfold from previous years. Those deaths officially attributed to the coronavirus accounted for barely a quarter of the increase. […] How many “excess deaths” are patients who have COVID-19 but haven’t been diagnosed with it, and how many are patients with other illnesses who can’t get proper treatment in overwhelmed hospital systems? […] In Bergamo, a city northeast of Milan, about 20 percent of all family physicians have been infected. [NY mag]

30 million Americans could lose their private health insurance over the next few months

American Indians have the highest rates of diseases that make covid-19 more lethal. Conditions in Indian Country are ripe for a rapid spread of the coronavirus. Rates of infection among Navajos is a major concern.

Gates said he was picking the top seven vaccine candidates and building manufacturing capacity for them. “Even though we’ll end up picking at most two of them, we’re going to fund factories for all seven, just so that we don’t waste time in serially saying, ‘OK, which vaccine works?’ and then building the factory,” he said. [Business Insider]

This notebook tries to estimate how many actual cases of SARS-COV-2 infections there might be today and contrasts this with the number of confirmed cases known today

How Taiwan has kept the virus under control

Some countries’ first impulses are to cover up the spread of the disease. We look at a few of those efforts, plus some brutal methods of enforcing stay-at-home orders. [Slate]

Every day, millions of people around the world type their health symptoms into Google. We can use these searches to help detect unknown Covid-19 outbreaks, particularly in parts of the world with poor testing infrastructure. […] There is now strong evidence that anosmia, or loss of smell, is a symptom of Covid-19, with some estimates suggesting that 30-60 percent of people with the disease experience this symptom. In the United States, in the week ending this past Saturday, searches for “I can’t smell” were highest in New York, New Jersey, Louisiana, and Michigan — four of the states with the highest prevalence of Covid-19. […] Searches for “no puedo oler” (“I can’t smell”) are some 10 times higher per Google search in Ecuador than they are in Spain, even though Ecuador officially reports more than ten times fewer Covid-19 cases per capita than Spain does. Ecuadorians are also right near the top in searches for fever, chills and diarrhea. […] searches for “non sento odori” (“I can’t smell”) were elevated in Italy days before the symptom was reported in the news. […] The three searches most related to Covid-19 disease rates were not a surprise: loss of smell, fever and chills. The fifth and sixth searches weren’t much of a surprise either: nasal congestion and diarrhea, which have also received a lot of attention as Covid-19 symptoms. However, the fourth-place search was a surprise: eye pain, which has not garnered much attention as a possible symptom of the disease. Seth Stephens-Davidowitz | NY Times

Report showed 43,000 fewer health-care jobs in mid-March than in mid-February. Hospital employment was almost precisely flat between the two months, but dental offices reported 17,000 fewer workers and doctors’ offices had 12,000 fewer. Since about three times as many Americans work in doctors’ offices as in dentists’ offices, that’s an especially hard hit to dental employment, which makes sense: Most dental services are not emergencies, and dental work creates significant risk of exposure to coronavirus. […] “There are jobs that people decided wouldn’t be affected by coronavirus because they could be done remotely, but those jobs are dependent on people paying for those services.” All that job loss across the economy means less spending power in households and at businesses. And that may mean less business even for enterprises that can adjust to the stay-at-home orders and keep doing business. [NY mag]

Your grocery shelves might be empty now, but there are countless number of people (and machines) working to refill them.

trapped in an eternal honeymoon in the Maldives

Berlin’s drug dealers adapt to life under coronavirus lockdown [Finacial Times | unlocked]

This is for all the landlords out there. [Thanks Tim]

Do we really need to weigh lives against money? If so, how do you do it right? […] As human beings, we tend to see life as having almost infinite value, but it’s also worth remembering that money spent to save one life has an opportunity cost: It could have been spent in another fashion and—if spent more efficiently—saved even more lives. Resources are never unlimited, and without assessing the dollars-to-lives tradeoff, it’s likely that policymakers will fail to save as many lives as they otherwise could. […] Here’s where assigning a dollar value to life-extending benefits enters the equation. One common way to do this is by using the “value of a statistical life,” or VSL, which reflects what current citizens are willing to pay to reduce their own risk of death. (It’s usually estimated by looking at how much extra compensation workers in dangerous professions get paid.) Estimates of the VSL vary, but tend to average about $10 million for Americans. If we assume, for example, that the government’s response to Covid-19 prevents an enormous death toll of 2 million citizens, the value of all those prevented deaths could be as much as $20 trillion. […] Cost-benefit analysis can offer us a way to think about decisions, and put some boundaries around the likely outcomes. But even in simpler circumstances, it cannot always provide bright-line recommendations. And it can’t answer our deepest and most profound questions. In some cases, the calculus has to be driven not by a set of numbers, but by our values. […] Contrary to popular belief, deaths go down during economic downturns. […] Suicides tend to be low in wartime […] The economy took a hit during the 1918 influenza pandemic, but cities that intervened earlier and more aggressively fared better. [Politico]

It is hard to start a new business, and if all the businesses shut down then it will be hard to start all new ones when the lockdowns end. […] The U.S. government has announced that small businesses can apply to banks for loans to cover their payrolls, and that if they actually use the money to pay workers—if they don’t lay people off—then the government’s Small Business Administration will forgive the loans. […] It is all very smart and elegant but there is a problem, which is that banks are a little nervous about vetting companies for the government and might just decline to do it. (The government will also guarantee the loans, even the ones that aren’t forgiven, so the banks take no credit risk.) Banks are, precisely, in the business of vetting applications from local restaurants, examining their financial records and deciding how much money they need. The government, meanwhile, is best equipped to generate magical quantities of money. […] It is all very smart and elegant but there is a problem, which is that banks are a little nervous about vetting companies for the government and might just decline to do it. [Matt Levine | Bloomberg]

Rich countries try radical economic policies to counter covid-19. History suggests that the effects will be permanent. [Economist]

This virus does have the ability to transmit far easier than flu. It’s probably now about three times as infectious as flu. One of the [pieces of] information that we have pretty much confirmed now is that a significant number of individuals that are infected actually remain asymptomatic. That may be as many as 25%. […] Of those of us that get symptomatic, it appears that we’re shedding significant virus in our oropharyngeal compartment, probably up to 48 hours before we show symptoms. This helps explain how rapidly this virus continues to spread across the country, because we have asymptomatic transmitters and we have individuals who are transmitting 48 hours before they become symptomatic. […] This virus cannot go from person to person that easily. It needs us to be close. It needs us to be within 6 feet. If we just distance ourselves, this virus can’t sustain itself and it will go out. [Dr. Robert Redfield, CDC Director | NPR]

Inside the Coronavirus Genome
Viruses must hijack living cells to replicate and spread. When the coronavirus finds a suitable cell, it injects a strand of RNA that contains the entire coronavirus genome. The first sequence of RNA letters reads: auuaaagguuuauaccuucccagguaacaaaccaaccaacuuucgaucucuuguagaucuguucucuaaacgaacuuuaaaaucuguguggcugucacucggcugcaugcuuagugcacucacgcaguauaauuaauaacuaauuacugucguugacaggacacgaguaacucgucuaucuucugcaggcugcuuacgguuucguccguguugcagccgaucaucagcacaucuagguuucguccgggugugaccgaaagguaag

Two episodes from The Daily, NY Times podcast: The Race for the Vaccine and Why the U.S. Is Running Out of Medical Supplies

It’s theoretically possible that coronavirus could infect the region of the brain responsible for smell. […] “The pure smell sense would be if you can smell a particular substance that’s not stimulating other nerves. […] For example, Ammonia or cleaning solutions, those stimulate the trigeminal nerve, which is an irritant nerve. And so people will think, ‘Oh, I can smell Clorox, I can smell ammonia, which means I can smell.’ But no, that’s not correct. They’re not actually smelling, they’re using the trigeminal nerve.”

For the first time in history, most American adults carry an always-on geolocation device—their smartphone—on their person most of the time. Many popular smartphone apps passively transmit user location—via cellular, GPS, WiFi, or Bluetooth technology—to app companies at all hours of the day. […] These are rich datasets that public health officials and researchers are using to evaluate shelter-at-home compliance and model COVID-19 transmission speeds. For example, officials in Austria and Italy are already using anonymized location information from mobile phone company records to examine the efficacy of their COVID-19 lockdowns.  Similar analysis is underway in the United States. […] If most residents are spending 22 hours in one location except for brief visits to the grocery store and parks, that is a reliable sign that people are engaging in fairly strict social distancing behaviors […] Combining these data with reported infection and hospitalization rates will allow policymakers to analyze various jurisdictions and geographic areas based on a matrix of risk levels. [Mercatus]

No-Sew Pleated Face Mask with Handkerchief and Hair Tie

Cumulative counts of COVID-19 cases by U.S. state over time

A pilot wrote a coronavirus message in the sky [March 19]

Unsolicited Advice for Living in the End Times

‘Zoombombing’ is a federal offense that could result in imprisonment, prosecutors warn

unrelated:

Have Smartphones Destroyed a Generation?

The caption of this photo probably triggered one of the biggest edit wars in Wikipedia’s history.

U.S. big bucks turn global face mask hunt into ‘Wild West’ - In France and Germany, senior officials said the United States was paying far above the market price for masks from No. 1 producer China, on occasion winning contracts through higher bids even after European buyers believed a deal was done, and Brazil’s health minister reported a similar incident. [Reuters]

Buying Face Masks and Other PPE from China Just Got a LOT Tougher

American states’ responses to the coronavirus follow party lines. Republican-leaning governors are slower to impose restrictions than Democrats [Economist]

Most experts agree that wearing a face mask can stop some virus-laden watery droplets that are thought to be a main coronavirus vector and are expelled into the air when a person coughs, sneezes, just breathes out [Financial Times] or talks [CNN]

Location Data From 131 Countries To Show How Coronavirus Lockdowns Are Working [Googler.com]

Location Data Says It All: Staying at Home During Coronavirus Is a Luxury

On March 14, Zahara cut itself off from the outside world as a dangerous coronavirus spread its tentacles across Spain. The mayor decided to block all but one of the town’s five entrances. Since then, the country has recorded more than 100,000 cases and 10,000 deaths, according to Johns Hopkins University figures. In Zahara, however, there has not been a single recorded case of Covid-19 among its 1,400 inhabitants. […] “There is no car that comes through the checkpoint that’s not disinfected. Every Monday and Thursday at 5:30 p.m. a group of around 10 people are out in the streets to disinfect the town, all the streets, plazas and outside homes.” A local business is paying two women to make grocery and medical deliveries to reduce the number of people out on the streets, especially those most vulnerable to contracting the virus. [CNN]

The logistics to get food from the field to the plate are being increasingly affected and point to longer-term problems.

What Everyone’s Getting Wrong About the Toilet Paper Shortage

COVID-19 Stress Tests the Cloud

Zoom’s Encryption Is ‘Not Suited for Secrets’ and Has Surprising Links To China, Researchers Discover

During the Tang dynasty, a golden age for poets, Empress Wu Chao forced every male dignitary who had an audience with her to wash his mouth with rose water and practice cunnilingus on her. Diplomats and courtiers had to do their best so that their requests were met, and even then it was not a guarantee, since Chinese politics have always been cunning and inscrutable, with oscillations between the sun and the shadow of yin and yang.

{ Taki’s Magazine | Continue reading }

related { Wu was the only empress regnant (or female emperor) in the history of China. }

The importance of viral dose is being overlooked in discussions of the coronavirus. As with any other poison, viruses are usually more dangerous in larger amounts. Small initial exposures tend to lead to mild or asymptomatic infections, while larger doses can be lethal. From a policy perspective, we need to consider that not all exposures to the coronavirus may be the same. Stepping into an office building that once had someone with the coronavirus in it is not as dangerous as sitting next to that infected person for an hourlong train commute. Both small and large amounts of virus can replicate within our cells and cause severe disease in vulnerable individuals such as the immunocompromised. In healthy people, however, immune systems respond as soon as they sense a virus growing inside. Recovery depends on which wins the race: viral spread or immune activation. Virus experts know that viral dose affects illness severity. In the lab, mice receiving a low dose of virus clear it and recover, while the same virus at a higher dose kills them. Dose sensitivity has been observed for every common acute viral infection that has been studied in lab animals, including coronaviruses. […] Low-dose infections can even engender immunity, protecting against high-dose exposures in the future. […] People should take particular care against high-dose exposures, which are most likely to occur in close in-person interactions — such as coffee meetings, crowded bars and quiet time in a room with Grandma — and from touching our faces after getting substantial amounts of virus on our hands. In-person interactions are more dangerous in enclosed spaces and at short distances, with dose escalating with exposure time. For transient interactions that violate the rule of maintaining six feet between you and others, such as paying a cashier at the grocery store, keep them brief — aim for “within six feet, only six seconds.” […] At the same time, we need to avoid a panicked overreaction to low-dose exposures. Clothing and food packaging that have been exposed to someone with the virus seem to present a low risk. Healthy people who are together in the grocery store or workplace experience a tolerable risk — so long as they take precautions like wearing surgical masks and spacing themselves out. [NY Times]

Millions of masks are being purchased by foreign buyers and are leaving the US, according to the brokers, while the domestic need remains alarmingly high. [Forbes]

The US bought out a planeload of Chinese-made face masks right on the tarmac just as the haul of the much needed protective gear was about to set off for France. “They pay double and cash, even before seeing the goods.” [Une commande française de masques détournée vers les Etats-Unis | France 3 | Libération]

US official denies claim that Americans have been snapping up Chinese masks previously ordered by France

Beijing is emerging from a roughly two-month coronavirus lockdown, forcing people to adapt to a new way of life [video]

The world could soon run out of space to store oil. That may plunge prices below zero

my boss turned herself into a potato on our Microsoft teams meeting and can’t figure out how to turn the setting off, so she was just stuck like this the entire meeting

The internet is now rife with places where you can organize Zoom-bombing raids

Data show that COVID-19 is now the No. 3 leading cause of daily deaths in the U.S.

China Concealed Extent of Virus Outbreak, U.S. Intelligence Says

Barely a month before Europe embarked on a scramble for masks, ventilators and testing kits to fight coronavirus, governments told Brussels their healthcare systems were ready and there was no need to order more stocks, EU documents show. [Reuters]

Here, we attempt to present an initial record of the federal government’s important official actions and communications over the past months, with a particular emphasis on the rules, regulation, and guidance related to the public health challenge.

Using the assumption that the suppression policy can achieve R0 = 1, we assess that it should be kept in place between 30 and 34 weeks. We further show that stopping the suppression policy before six weeks does not produce any meaningful improvements in the pandemic outcome. [PDF]

We conclude that viral spread is too fast to be contained by manual contact tracing, but could be controlled if this process was faster, more efficient and happened at scale. A contact-tracing App which builds a memory of proximity contacts and immediately notifies contacts of positive cases can achieve epidemic control if used by enough people. By targeting recommendations to only those at risk, epidemics could be contained without need for mass quarantines (‘lock-downs’) that are harmful to society.

Private Labs Are Fueling a New Coronavirus Testing Crisis

Researchers find AI is bad at predicting GPA, grit, eviction, job training, layoffs, and material hardship

Auto insurers are collecting billions in extra profit as Americans shelter in place

Group Behind Central Park Coronavirus Tent Hospital Asks Volunteers To Support Anti-Gay Agenda

Another security researcher found two new Zoom bugs that can be used to take over a Zoom user’s Mac, including tapping into the webcam and microphone.

What happened to Reyna is a popular Cash App scam called “cash-flipping”

In the coming weeks, if they have not already, your government is likely to begin advising you to wear a face mask to protect against coronavirus.

A growing number of experts — medical doctors and virologists among them — say that a homemade mask, even a bandanna, might provide protection from both transmitting and getting the coronavirus. But because there is little research to indicate how well or what homemade masks work, there is no consensus among experts on a best design, and the scientists we spoke to were reluctant to endorse any one homemade mask pattern.

Social distancing works. The earlier the better, California and Washington data show.

COVID-19 Trials Tracker

A team of Chinese scientists has isolated several antibodies that it says are “extremely effective” at blocking the ability of the new coronavirus to enter cells, which eventually could be helpful in treating or preventing COVID-19. [Reuters]

We further show that stopping the suppression policy before six weeks does not produce any meaningful improvements in the pandemic outcome.

Two months of mitigations have not improved the outcome of the epidemic in this model, it has just delayed its terrible effects. In fact, because of the role of weather in the model presented in the Kristof article, two months of mitigations actually results in 50% more infections and deaths than two weeks of mitigations, since it pushes the peak of the epidemic to the winter instead of the summer, whose warmer months this model assumes causes lower transmission rates. […] This is simply because as long as a large majority of the population remains uninfected, lifting containment measures will lead to an epidemic almost as large as would happen without having mitigations in place at all. […] This is not to say that there are not good reasons to use mitigations as a delay tactic. For example, we may hope to use the months we buy with containment measures to improve hospital capacity, in the hopes of achieving a reduction in the mortality rate. […] What should be absolutely clear is that hard decisions lie ahead, and that there are no easy answers. [Maria Chikina and Wesley Pegden]

Do people who survive the infection become immune to the virus? The answer is a qualified yes, with some significant unknowns. That’s important for several reasons. […] Immunity may bring an early treatment. Antibodies gathered from the bodies of those who have recovered may be used to aid those struggling with the illness caused by the coronavirus, called Covid-19. […] Gov. Andrew M. Cuomo announced that New York would become the first state to begin testing serum from people who have recovered from Covid-19 to treat those who are seriously ill. […] Antibodies to the coronaviruses that cause the common cold persist for just one to three years — and that may be true of their new cousin as well. A study in macaques infected with the new coronavirus suggested that once infected, the monkeys produce neutralizing antibodies and resist further infection. But it is unclear how long the monkeys, or people infected with the virus, will remain immune. Most people who became infected during the SARS epidemic — that virus is a close cousin of the new coronavirus, called SARS-CoV-2 — had long-term immunity lasting eight to 10 years, said Vineet D. Menachery, a virologist at the University of Texas Medical Branch at Galveston. Those who recovered from MERS, another coronavirus, saw much shorter-term protection, Dr. Menachery said. People who have been infected with the new coronavirus may have immunity lasting at least one to two years, he added: “Beyond that, we can’t predict.” Still, even if antibody protection were short-lasting and people became reinfected, the second bout with the coronavirus would likely be much milder than the first, said Florian Krammer, a microbiologist at the Icahn School of Medicine at Mount Sinai in New York. […] Ultimately, it is only with these tests that scientists will be able to say when enough of the population has been infected and has become immune — and when the virus has begun to run out of hosts. [NY Times]

A person contracts the virus sharing the same airspace — a six-foot radius, the distance droplet nuclei are believed to travel (although with coughing they may travel farther) — and inhaling the infectious particles. Or the droplet nuclei land on an object or surface, making it infectious. Touch that surface and then your face and the chain of transmission is complete. If you do have sex with someone who is infected with the new coronavirus, there is nothing we can recommend, be it showering head to toe with soap before and immediately after sex, or using condoms, to reduce your risk of infection. We don’t know if the new coronavirus is present in vaginal secretions or ejaculate, but it has been identified in stool. Based on what we currently know about transmission of coronavirus, penetrative vaginal or anal sex or oral sex seem unlikely to pose a significant risk of transmission. [NY Times]

While political leaders have locked their borders, scientists have been shattering theirs, creating a global collaboration unlike any in history. Never before, researchers say, have so many experts in so many countries focused simultaneously on a single topic and with such urgency. Nearly all research, other than anything related to coronavirus, has ground to a halt. [NY Times]

Is there hope that something will be available soon to help us fight this virus? Here’s a look at what’s on tap and how soon it could be ready.

COVID-19 and Pretrial Detention

COVID-19 State and Local Policy Dashboard that provides a quick and easy reference to updates and information issued by state and key local agencies and policymakers (updated daily)

Mapping the Coronavirus Outbreak Across the World

Key Economic Facts About COVID-19

Zoom Meetings Aren’t End-to-End Encrypted, Despite Misleading Marketing

Popular video-conferencing Zoom is leaking personal information of at least thousands of users, including their email address and photo, and giving strangers the ability to attempt to start a video call with them through Zoom. [Vice]

Il ne faut pas avoir peur de s’ennuyer, comme disait Paul Valéry. L’ennui, c’est la vie toute nue. L’existence, quand elle se regarde, est toujours un peu ennuyeuse. [Roger-Pol Droit | France Culture]

It has been reported that several cases recovered from COVID-19 tested positive after discharge (re-detectable positive, RP). […] All of patients were followed up for at least 14 days, and 38/262 of RP patients (14.5%) were present. The RP patients were characterized by being less than 14-years old and having mild and moderate conditions as compared to NRP patients, while no severe patients became RP. […] Our results showed that young and mild COVID-19 patients seem to be RP patients after discharge, who show no obviously clinical symptoms and disease progression upon re-admission. [medRxiv ]

How many people die after being infected with the novel coronavirus? Fewer than previously calculated, according to a study released Monday. The research estimated that about 0.66% of those infected with the virus will die.

Doctors in the Bay Area see flatter curve after 2 weeks of social isolation

Armed vigilantes blocked a neighbor’s driveway with a tree to force him into quarantine

Drone technology is ready to break out into a mass service and reduce person-to-person contact. There are a few dozen pilot programs throughout the United States and some limited commercial deployments for services such as medical delivery, parcel delivery, utilities inspection, and crop spraying.

At least two peer-reviewed studies show that while DIY masks are not nearly as effective as commercial masks made for health care workers, they are far better than nothing. Homemade masks both limit the spread of infectious droplets in the air and discourage people from touching their faces. [DIY using some T-shirt fabric, elastic ribbon, scissors, sewing supplies or scissors and a T-shirt]

list of companies freezing hiring or doing layoffs (and those that are still hiring). [Thanks Tim]

A number of studies – including our own – find a mid-life dip in well-being. […] The effects of the mid-life dip are comparable to major life events like losing a spouse, losing a job or getting cancer. They are clearly not inconsequential.

{ National Bureau of Economic Research | Continue reading }

A Brooklyn-based photographer asked out his neighbor via drone, after seeing her dance on her rooftop

Johnson & Johnson is five months away from starting human trials on a COVID-19 vaccine, the pharmaceutical giant said Monday. Clinical data would be available by the end of the year, leaving open the possibility of emergency-use authorization by early next year. [NY mag]

Germany will issue coronavirus antibody certificates to allow quarantined to re-enter society

How stress can cause a fever

Traffickers and militiamen have established curfews in favelas after confirmation of cases of coronavirus infections in communities in Rio. Criminals also make threats to residents who are caught circulating in the favelas after 8 pm. In Cidade de Deus, in the West Zone, the first community in Rio to have a confirmed case, the traffickers circulated through the favela with a loudspeaker yesterday afternoon. [Globo | Thanks Andrea]

Every disaster shakes loose the old order. […] The possibilities for change, for the better or the worse, for a more egalitarian or more authoritarian society, burst out of the gate like racehorses at times like these. […] The George W. Bush administration used Sept. 11 as a pretext to strip Americans of their civil liberties, to conduct a pair of wars that were themselves humanitarian, diplomatic and economic catastrophes, and to amplify its own authority. […] No one knows yet what will come out of this crisis. But like so many other disasters, this one has revealed how interconnected we are; how much we depend on the labor and good will of others; how deeply enmeshed we are in social, ecological and economic systems; and how prevention or survival of something as deeply, bodily personal as a disease depends on our collective decisions and those of our leadership. It has also revealed how squalid the Trump administration’s selfishness is; early reports suggested — and a presidential tweet on Wednesday reiterated — that Mr. Trump viewed the pandemic as primarily about how it would affect his re-election chances and sought to minimize it for his own sake rather than respond to it as we needed. Most recently he and the Republican congressional leadership have aimed a bailout package at large corporations rather than citizens and, while fumbling delivery of urgently needed medical supplies, made proposals focused on keeping the market strong rather than human beings safe. [Rebecca Solnit | NY Times]

A wooden table, a tablecloth, a glass of wine and two neighbors in Porto San Giorgio manage to have lunch together [Thanks Andrea!]

The Seattle area, home of the first known coronavirus case in the United States and the place where the virus claimed 37 of its first 50 victims, is now seeing evidence that strict containment strategies, imposed in the earliest days of the outbreak, are beginning to pay off. While each infected person was spreading the virus to an average of 2.7 other people earlier in March, that number appears to have dropped, with one projection suggesting that it was now down to 1.4.

The study found high levels of contamination on commonly used surfaces and in the air of patients’ rooms. Samples of air from hallways outside of patient rooms were also positive. [WOWT]

Estimates Show Wuhan Death Toll Far Higher Than Official Figure — “because the incinerators have been working round the clock, so how can so few people have died?”

Report of Urns Stacked at Wuhan Funeral Homes Raises Questions About the Real Coronavirus Death Toll in China [Time]

Simple DIY masks could help flatten the curve. We should all wear them in public. […] My data-focused research institute, fast.ai, has found 34 scientific papers indicating basic masks can be effective in reducing virus transmission in public — and not a single paper that shows clear evidence that they cannot. [Washington Post]

Would everyone wearing face masks help us slow the pandemic?

sars-CoV-2 behaves like a monstrous mutant hybrid of all the human coronaviruses that came before it. It can infect and replicate throughout our airways. “That’s why it is so bad,” Stanley Perlman, a professor of microbiology and immunology who has been studying coronaviruses for more than three decades, told me. “It has the lower-respiratory severity of sars and mers coronaviruses, and the transmissibility of cold coronaviruses.” [New Yorker]

The Race for Virus Money Is On. Lobbyists Are Standing By. — A South Carolina company has hired a lobbyist close to President Trump to try to win regulatory approval to sell a misting spray to kill coronavirus on airplanes. A Manhattan company is seeking money from the $2 trillion stimulus package for its quick-change recyclable hospital curtains. [NY Times]

Last week wholesale egg prices rose more than 50 percent in some parts of the country, because of demand; eggs have been running low if not sold out altogether in many stores in the United States. The egg supply is normal, of course; demand just grew significantly. […] Compared with usual chick sales in March, sales at Hackett Farm Supply in Clinton Corners, N.Y., have nearly doubled. “People are willing to take breeds that aren’t their first choice just to get a flock started now,” said Stephanie Spann, the store manager.
[NY Times]

The email came from the boss. We’re watching you, it told Axos Financial Inc. employees working from home. We’re capturing your keystrokes. We’re logging the websites you visit. Every 10 minutes or so, we’re taking a screen shot. So get to work — or face the consequences. [Bloomberg]

What a World of Warcraft virtual outbreak taught us about how humans behave in epidemics [Thanks Andrea!]

How COVID-19 Led Merriam-Webster to Make Its Fastest Update Ever [Thanks Andrea!]

How some cities “flattened the curve” during the 1918 flu pandemic

Trump Seeks To Stimulate Economy By Sending Rare Autographed Photo To Every American

In other news… the cat over the road is called Walter

Alone Together (The World vs. SARS-CoV-2)

march 28

Some Wuhan residents who had tested positive earlier and then recovered from the disease are testing positive for the virus a second time. Based on data from several quarantine facilities in the city, which house patients for further observation after their discharge from hospitals, about 5%-10% of patients pronounced “recovered” have tested positive again. Some of those who retested positive appear to be asymptomatic carriers — those who carry the virus and are possibly infectious but do not exhibit any of the illness’s associated symptoms — suggesting that the outbreak in Wuhan is not close to being over. [NPR]

Is ‘Viral Load’ Why Some People Get a Mild Case of COVID-19?

In China, 52.9 percent of men smoke, in contrast to just 2.4 percent of women; further analysis of the emerging COVID-19 data from China could help determine if this disparity is contributing to the higher mortality observed in men compared to women

Roughly speaking, we might say that getting COVID-19 is like packing a year’s worth of risk into a week or two.

list of rent strike resources and information from the USA, Canada, the UK, and Australia

The US keeps millions of chickens in secret farms to make flu vaccines. But their eggs won’t work for coronavirus

He recalls bringing it to one veteran Democratic member. “I said, ‘I need to talk to you about something important,’” says Baird. “He said, ‘What’s that?’ I said, ‘You know, we don’t have a valid process for replacing House members if we’re all killed by a terrorist attack.’” “He said, ‘What do I care? I’ll be dead.’” Why Is Congress Still Meeting in Person?

Drug Dealers on How Coronavirus Is Affecting Supply and Demand

Related: The team tested wastewater samples from 68 European cities in 23 countries, looking for urinary biomarkers or urinary metabolites for cocaine, MDMA, cannabis, amphetamine, and methamphetamine found in European wastewater. The countries with the overall highest concentration of urinary biomarkers for MDMA were Belgium, Germany, and the Netherlands. Cocaine use appeared to be highest in the United Kingdom, Belgium, the Netherlands, and Spain. [Daily Mail]

march 27:

When Boeing made its humble plea for $60 billion in coronavirus relief funds on Saint Patrick’s Day 2020, leading the pack of corporate supplicants, all its assembly lines unrelated to its notorious self-hijacking 737 Max jets, whose production halted in January, were still operating at normal capacity. They were still open in spite of the fact that Seattle public schools had been closed for six days at that point, in spite of the fact that every restaurant and bar in the state had been closed the weekend earlier, and in spite of the fact that the disease was quickly spreading among the factory workers, one of whom, a 27-year veteran of the company, would die within days. And they were still running in spite of the fact that demand for Boeing planes, thanks to the 737 crashes, is at an all-time low, with the company in January, a month in which its archrival Airbus sold 274 planes, reporting its first month in history without a single order. Which is to say, I can think of a lot of reasons Boeing might need a bailout. In December a space capsule the company designed to transport astronauts to the International Space Station failed to launch into orbit during a test mission because its timer was eleven hours off, a potentially half billion dollar mistake that may cost the company billions more in lost NASA business to Elon Musk’s SpaceX. In January, the company revealed that its attempts to load a software fix onto the 737s was repeatedly crashing the planes’ computers. Not long after that, the company finally admitted that the three-year-delay on its KC-46 aerial refueling tanker was going to be, at minimum, another three years. And then of course there’s the $70 billion the company has squandered over the past decade on stock buybacks and dividend checks. What all of these problems have in common is that none of them has shit to do with coronavirus. And neither does the $500 billion corporate bailout the Senate appended to an otherwise vitally important relief package. [Moe Tkacik]

14 years ago, Larry Brilliant, the epidemiologist who helped eradicate smallpox, spoke to a TED audience and described what the next pandemic would look like. At the time, it sounded almost too horrible to take seriously. “A billion people would get sick,” he said. “As many as 165 million people would die. There would be a global recession and depression, and the cost to our economy of $1 to $3 trillion would be far worse for everyone than merely 100 million people dying, because so many more people would lose their jobs and their health care benefits, that the consequences are almost unthinkable.” […] Larry Brilliant: “The whole epidemiological community has been warning everybody for the past 10 or 15 years that it wasn’t a question of whether we were going to have a pandemic like this. It was simply when. […] By slowing down the curve, or flattening it, we’re not going to decrease the total number of cases, we’re going to postpone many cases, until we get a vaccine—which we will, because there’s nothing in the virology that makes me frightened that we won’t get a vaccine in 12 to 18 months. […] The world is not going to begin to look normal until three things have happened. One, we figure out whether the distribution of this virus looks like an iceberg, which is one-seventh above the water, or a pyramid, where we see everything. If we’re only seeing right now one-seventh of the actual disease because we’re not testing enough, and we’re just blind to it, then we’re in a world of hurt. Two, we have a treatment that works, a vaccine or antiviral. And three, maybe most important, we begin to see large numbers of people—in particular nurses, home health care providers, doctors, policemen, firemen, and teachers who have had the disease—are immune, and we have tested them to know that they are not infectious any longer. And we have a system that identifies them, either a concert wristband or a card with their photograph and some kind of a stamp on it. Then we can be comfortable sending our children back to school, because we know the teacher is not infectious.” [WIRED]

march 26:

Coronavirus Info-Database, an attempt to organize the disparate papers, articles and links

The coronavirus is slowly mutating. But experts say that so far, there’s no sign it’s becoming more harmful to humans — and that slow change is potentially good news for treatments and vaccines.

Italian researchers are looking at whether a higher than usual number of cases of severe pneumonia and flu in Lombardy in the last quarter of 2019 may be a signal that the new coronavirus might have spread beyond China earlier than previously thought.

A ‘negative’ coronavirus test result doesn’t always mean you are not infected

Variation in state quarantine laws and regulations may create differences in the effectiveness of each state’s response to COVID-19, at least to the degree that those laws and regulations are relevant and enforced.

An app to connect, organize and help each other without risking physical contact and New Nextdoor Features

Edvard Munch, Self-Portrait With the Spanish Flu, 1919

march 25:

Nuclear scientists in Austria are closing in on new coronavirus testing kits that could dramatically lower the cost and time it takes to diagnose people for the disease. Covid-19 diagnosis could drop to 10 to 15 euros a person.

We need to test as many people as possible. If we know who is infected, who is not and who has recovered, we could greatly relax social isolation requirements and send both the uninfected and the recovered back to work. Although our health-care system is now struggling to produce enough tests even for those who are likely infected, we recommend a massive mobilization that would allow hundreds of millions to be tested. There are two types of tests, and expanding both would be necessary. The polymerase chain reaction, or PCR, test now in use identifies the genetic signature of the live virus and can identify those very recently infected. It requires someone to take swabs and package them, use of a PCR machine and trained professionals to run those machines. The second type of test, a serology test, looks for antibodies or other proteins in the blood formed by the immune reaction to infection. These tests, still in development, could reveal those who had the disease and recovered, and confirm infection of some still with symptoms. It could probably be self-administered and produce results in minutes. With enough of both kinds of tests, a variety of complementary strategies would be possible. Because live disease carriers would be more readily identified, it would be easier to trace and test their contacts and to quarantine the infected, particularly if a period of high isolation now greatly lowers infection rates. In addition, with widespread serology tests, those recovered and presumably now immune and unable to transmit the virus could return to work and resume many social interactions. Although no one is absolutely sure the recovered cannot be reinfected and then infect others, they will almost certainly have substantial resistance. [Washington Post]

Singapore to make its contact-tracing app freely available to developers worldwide

coronavirus RNA found in Princess Cruise ship cabins up to 17 days after passengers left

10 Amazon warehouses hit by coronavirus

Hedge fund manager Bill Ackman says he turned $27 million into $2.6 billion during coronavirus crisis

the legend that there is a baby boom nine months after any natural disaster has been debunked, repeatedly

If we do the testing of every single case, rapid isolation of the cases, you should be able to keep cases down low. If you simply rely on the big shut down measures without finding every case, then every time you take the brakes off, it could come back in waves. So that future frankly, may be determined by us and our response as much as the virus.

“If 30% of the population has already been exposed to this then that number will go to 70% in two weeks,” James said. Assuming that having the disease left you with immunity to it, the crisis would then be as good as over

If you have a smartphone, you’re probably contributing to a massive coronavirus surveillance system. And it’s revealing where Americans have — and haven’t — been practicing social distancing. A company called Unacast that collects and analyzes phone GPS location data launched a “Social Distancing Scoreboard” that grades, county by county, which residents are changing behavior at the urging of health officials. It uses the reduction in the total distance we travel as a rough index for whether we’re staying put at home. Comparing the nation’s mass movements from March 20 to an average Friday, Washington, D.C., gets an A, while Wyoming as a whole earns an F. [Washington Post]

A new study of the inner workings of our muscles finds that if muscles have been trained in the past, they seem to develop a molecular memory of working out that lingers through a prolonged period of inactivity, and once we start training again, this “muscle memory” could speed the process by which we regain our former muscular strength and size. [NY Times]

3D printed adapter to turn snorkeling mask into a non-invasive ventilator

How did such a simple thing as soap and warm water — and alcohol-based sanitizers — obtain such power over these parasites?

in other news:

Keeping a smartphone in hand and frequent checking is associated with extraversion and poorer performance on tests of sustained attention and general intelligence, particularly semantic reasoning.

according to a new study, many people will reject their own arguments - if they’re tricked into thinking that other people proposed them

we argue that, at times, the desire to appear honest can actually lead people to lie.

The Liar’s Walk: Detecting Deception with Gait and Gesture

Switzerland has voted as many times as all of the other countries in the world put together in the past century.

Things you can do with a browser in 2020

Where Did “Tibetan” Singing Bowls Really Come From?

Warhol’s Photo of a Painting of a Photo