The largest Arctic ozone hole ever recorded is now closed

Facial recognition has become more widespread and accurate in recent years, as an artificial intelligence technology called deep learning made computers much better at interpreting images. Governments and private companies use facial recognition to identify people at workplaces, schools, and airports, among other places, although some algorithms perform less well on women and people with darker skin tones. Now the facial-recognition industry is trying to adapt to a world where many people keep their faces covered to avoid spreading disease. […] “We can identify a person wearing a balaclava, or a medical mask and a hat covering the forehead,” says Artem Kuharenko, founder of NtechLab, a Russian company whose technology is deployed on 150,000 cameras in Moscow. He says that the company has experience with face masks through contracts in southeast Asia, where masks are worn to curb colds and flu. US Customs and Border Protection, which uses facial recognition on travelers boarding international flights at US airports, says its technology can identify masked faces. But Anil Jain, a professor at Michigan State University who works on facial recognition and biometrics, says such claims can’t be easily verified. [WIRED | Previously: Frustration grows in China as face masks compromise facial recognition ]

Danes and Czechs say easing lockdowns has produced no Covid-19 surge, South Korea reports no new cases

Does the amount of virus exposure affect disease severity? It looks that way. Many health care workers have become seriously ill with COVID-19, despite being young and healthy. Various reports have suggested it’s because they were exposed to more virus than a typical COVID-19 patient. This is consistent with experimental studies of porcine respiratory coronavirus (PRCV). Scientists found pigs that were inoculated with it developed more severe cases than the pigs that caught the disease naturally. This makes logical sense, since the higher the amount of virus infecting you, the harder it is for your body to control its replication and spread. […] One outcome: The disease could become milder with time. This may have happened with HCoV-OC43, which appears to have diverged from its ancestral virus BCoV around 1890, when it jumped from cattle to humans. Coincidentally, that was also the year of a nasty influenza epidemic — though it may very well have been a coronavirus outbreak, like today’s. The increased mildness of HCoV-OC43 may have been facilitated in part by the deletion of 290 base pairs of the virus’s RNA near the spike gene, which allows a virus to penetrate and infect its host’s cells. This deletion likely hindered its ability to bind effectively, making it harder to produce severe infections. Such evolution by deletion is actually a common feature of these viruses. […] Another possible outcome if SARS-CoV-2 never goes away: recombination, where the virus mixes and matches its genetic material with those of other circulating coronaviruses. These events are frequent, and they can result in the emergence of entirely new viruses. [Quanta]

Four coronaviruses cause around a quarter of all common colds, but each was probably deadly when it first made the leap to humans. What four coronaviruses from history can tell us about covid-19

How Coronavirus Mutates and Spreads

In the early 1950s, psychiatrists began treating schizophrenia with a new drug called chlorpromazine. Seven decades later, the drug is still used as an anti-psychotic.
But now scientists have discovered that the drug, also known as Thorazine, can do something entirely different. It can stop the new coronavirus that causes Covid-19 from invading cells. Driven by the pandemic’s spread, research teams have been screening thousands of drugs to see if they have this unexpected potential to fight the coronavirus. […] The researchers determined that the virus manipulates our cells by locking onto at least 332 of our own proteins. By manipulating those proteins, the virus gets our cells to make new viruses. Dr. Krogan’s team found 69 drugs that target the same proteins in our cells the virus does. They published the list in a preprint last month, suggesting that some might prove effective against Covid-19. […] Most of the 69 candidates did fail. But both in Paris and New York, the researchers found that nine drugs drove the virus down. […] “The things we’re finding are 10 to a hundred times more potent than remdesivir,” Dr. Krogan said. […] Dr. Frieman and Dr. Chanda also found that chloroquine-related drugs worked fairly well in slowing the virus in cell cultures. But Dr. Chanda found they didn’t work as well as the six compounds at the top of his list. [NY Times]

Even assuming that immunity is long-lasting, a very large number of people must be infected to reach the herd immunity threshold required. Given that current estimates suggest roughly 0.5 percent to 1 percent of all infections are fatal, that means a lot of deaths. Perhaps most important to understand, the virus doesn’t magically disappear when the herd immunity threshold is reached. That’s not when things stop — it’s only when they start to slow down.

What Is ‘Covid Toe’? Maybe a Strange Sign of Coronavirus Infection

Researchers are testing whether decades-old vaccines for polio and tuberculosis could protect against infection

Zen Japanese Rock Garden Toast

Changes in sexual behaviors of young women and men during the coronavirus disease 2019 outbreak (44% of participants reported a decrease in the number of sexual partners and about 37% of participants reported a decrease in sexual frequency)

The effect of facial hair and sex on the dispersal of bacteria below a masked subject (mask wiggling has been reported to increase dermabrasion and bacterial contamination of surfaces immediately below the face … Bearded males may also consider removing their beards)

how much COVID-19 related thinking is too much

Eight Labrador retrievers are being trained to sniff out coronavirus cases. It would not be surprising if the dogs prove adept at detecting SARS-CoV-2. In addition to drugs, explosives and contraband food items, dogs are able to sniff out malaria, cancers and even a bacterium ravaging Florida’s citrus groves. Research has found viruses have specific odors.

Remdesivir, which must be given intravenously, is likely to remain a treatment for patients who are hospitalized. But it is also likely that it will be most effective in patients who have been infected more recently, said Nahid Bhadelia, medical director of the special pathogens unit at Boston Medical Center. “We know that with most antiviral medications the earlier you give it the better it is.” That means that better diagnostic testing will be essential to identifying patients who could benefit. [STAT]

Researchers say people can catch mild, cold-causing coronaviruses twice in the same year. The research included four coronaviruses, HKU1, NL63, OC42, and C229E, which circulate widely every year but don’t get much attention because they only cause common colds. [study]

COVID-19 study shows that men have over double the death rate of women

In summary, COVID-19 might be associated with hypercoagulability

The US already has the technology to test millions of people a day

Five things we need to do to make contact tracing really work (It won’t be easy)

“As we speak, there are 100 hairless mice being exposed for 15 months,” said David J. Brenner, director of Columbia’s Center for Radiological Research. The mice live under the lights eight hours a day and get eye and skin tests every couple of weeks, and after eight months the researchers have found no damage, “which is encouraging.” The lamps could have helped prevent the spread of covid-19, Brenner said, but “it’s come a little too soon for us. If it had come at this time next year, we’d be in a good position to fight it.” […] Boeing is experimenting with lavatories that can sanitize themselves in less than three seconds. Engineers at the U.S. manufacturer and its top competitor, Airbus, have explored changing the way air moves around passengers to reduce infections. [Washington Post]

Current antibody surveys are revealing, furthermore, that immunity to COVID-19 can vary widely from location to location. The pandemic may be global but, as Yonatan Grad, an immunologist at Harvard University, told me, “it is made up of hyperlocal epidemics that are differentially impacting communities.”

Sewage may be key to tracking covid-19 outbreaks, researchers find. Researchers have detected genetic traces of the coronavirus in the wastewater in the Bay Area in California and in Massachusetts, as well as in European cities including Rome, Paris and Amsterdam.

Florida has at least two obvious advantages over somewhere like New York when it comes to keeping one’s distance: More people live in single-family homes, and more people travel by car than public transportation.

Coronavirus: ‘I’m tattooing myself every day in lockdown, but I’m running out of space’

Drink Camel Urine To Cure Coronavirus, Prophetic Medicine Man Says (w/ video)

In this paper, we explore different channels to explain the disparities in COVID- 19 incidence across New York City neighborhoods. … We find evidence consistent with higher intra-household contagion as days go by. … Although commuting patterns have been put forth as a major factor in the spread of the disease in NYC, we show that, after including occupation controls, they fail to significantly explain variation in share of positive tests at the zip code level. [Previously: Home outbreaks were the dominant category, followed by transport]

In NSW, from March to mid-April 2020, 18 individuals (9 students and 9 staff) from 15 schools were confirmed as COVID-19 cases; all of these individuals had an opportunity to transmit the COVID-19 virus (SARS-CoV-2) to others in their schools. 735 students and 128 staff were close contacts of these initial 18 cases. One child from a primary school and one child from a high school may have contracted COVID-19 from the initial cases at their schools. No teacher or staff member contracted COVID-19 from any of the initial school cases. [NCIRS]

The proposed full scale model (applied to real COVID-19 dynamics in London, Moscow and New York City) shows that top 10% spreaders (100+ higher viral loading than median infector) transmit 45% of new cases. Rapid isolation of superspreaders leads to 4-8 fold mitigation of pandemic depending on applied quarantine strength and amount of currently infected people. New testing strategy may prevent thousand or millions COVID-19 deaths requiring just about 5000 daily RT-PCR test for big 12 million city such as Moscow. [medRxiv]

We find that mass-testing is much less effective than testing the symptomatic and contact tracing, and some blend of these with social distancing is required to achieve suppression. […] Even with an expectation of less than one new case per person, our model shows that exponential spread is possible. […] Without full lockdown, mass testing of the general population to search for unknown infected individuals is mostly futile for containment, since it would require near universal testing to be effective, which is far beyond current capacity. […] To create containment, we need to test 30% of the population every day. If we only test 10% of the population every day, we get 34% of the population infected - no containment. [Modeling COVID-19 on a network: super-spreaders, testing and containment]

We use mobile-phone-data-based counts of 11,478,484 people egressing or transiting through the prefecture of Wuhan between 1 January and 24 January 2020 as they moved to 296 prefectures throughout China. First, we document the efficacy of quarantine in ceasing movement. Second, we show that the distribution of population outflow from Wuhan accurately predicts the relative frequency and geographic distribution of COVID-19 infections through February 19, 2020, across all of China. Third, we develop a spatio-temporal “risk source” model that leverages population flow data (which operationalizes risk emanating from epidemic epicenters) to not only forecast confirmed cases, but also to identify high-transmission-risk locales at an early stage. Fourth, we use this risk source model to statistically derive the geographic spread of COVID-19 and the growth pattern based on the population outflow from Wuhan. [Nature]

Chinese scientists report that they captured tiny droplets containing the genetic markers of the virus from the air in two hospitals in Wuhan, China, where the outbreak started. It remains unknown if the virus in the samples they collected was infectious, but droplets that small, which are expelled by breathing and talking, can remain aloft and be inhaled by others. Scientists do not know yet whether the viruses remain infectious or whether the tests just detected harmless virus fragments. [NY Times | Nature]

The new serological data, which is provisional, suggests that coronavirus infections greatly outnumber confirmed covid-19 cases, potentially by a factor of 10 or more. Higher infection rates mean lower lethality risk on average. But the corollary is that this is a very contagious disease capable of being spread by people who are asymptomatic. […] an infection fatality rate between 0.5 and 0.8 percent, depending on which death toll is factored in. […] A rate of 0.5 percent “is way more than a usual flu season and I would think way more than the ’57 or 1968 [influenza] pandemic death toll, too,” Viboud said. […] Epidemiologists have said somewhere between 40 to 70 percent of the population will likely become infected in the next couple of years if there is no vaccine and the public does not take aggressive measures to limit the spread of the virus. “Do the math!” [Washington Post]

Jan Albert, a professor in the Department of Microbiology, Tumor and Cell Biology at the Karolinska Institutet in Sweden: “It’s clear that Sweden had more deaths [than many other European countries] up until now, and that’s probably at least in part because we haven’t had as strict a lockdown and not a lockdown enforced by law. What’s the strategy of the other countries?” he asked. “It [herd immunity] was already the only thing that will eventually stop this, unless there is a vaccine in time, which is quite unlikely. “The truth is that no one, no one in Sweden, no one elsewhere either, knows what the best strategy is. Time will tell.” He said that he believed that stricter lockdowns “only serve to flatten the curve and flattening the curve doesn’t mean that cases disappear — they are just moved in time.” [CNN]

Africa’s youthful population may also help to explain the low death rate so far. The median age in Africa is 19.4 years, compared with 40 in Europe and 38 in the US.

Japan’s northern island of Hokkaido offers a grim lesson in the next phase of the battle against COVID-19. It acted quickly and contained an early outbreak of the coronavirus with a 3-week lockdown. But, when the governor lifted restrictions, a second wave of infections hit even harder. [Twenty-six days later, the island was forced back into lockdown.]

The Belgian government has reportedly been considering allowing people to form “social bubbles” of 10 people. The memo proposed that a bubble of people could spend time together on weekends, as long as all 10 people agreed to socialize exclusively with each other.

In Vilnius, Lithuania, some cafés will be able to set up outdoor tables free of charge

Big tech doesn’t build anything. It’s not likely to give us vaccines or diagnostic tests. We don’t even seem to know how to make a cotton swab. Those hoping the US could turn its dominant tech industry into a dynamo of innovation against the pandemic will be disappointed. The pandemic shows that the US is no longer much good at coming up with technologies relevant to our most basic needs.

Combining these large-scale data with a transmission model of social interactions and transmission in four settings (home, school, work, other) we were able to simulate where contacts are typically made, and how effective different approaches might be. […] If there were 10,000 new symptomatic cases per day, it meant around 150,000 to 400,000 contacts would be quarantined each day under the scenarios we considered. […] We also looked Iceland-scale mass population testing (i.e. 0.7% of population per day). Such testing would be very helpful for monitoring the epidemic, but unsurprisingly it had a negligible impact on reducing transmission, because cases would be detected too late (if at all) [Adam Kucharski, Twitter thread]

Of the 661 participants, 171 participants (25.9%) had anti-SARS-CoV-2 antibodies. […] The proportion of infected individuals who had no symptoms during the study period was 17.0%. […] The infection attack rate (IAR) was defined as the proportion of participants with confirmed SARS-CoV-2 infection based on antibody detection. […] The relatively low IAR observed in an area where SARS-CoV-2 actively circulated weeks before confinement measures indicates that establishing herd immunity will take time, and that lifting these measures in France will be long and complex. [medRxiv]

A small but rising number of children are becoming ill with a rare syndrome that could be linked to coronavirus, with reported cases showing symptoms of abdominal pain, gastrointestinal symptoms and cardiac inflammation

We Still Don’t Know How the Coronavirus Is Killing Us

Mortality statistics show 122,000 deaths in excess of normal levels across these locations, considerably higher than the 77,000 official Covid-19 deaths reported for the same places and time periods.

Women are better at fighting Covid-19, so doctors are giving men estrogen patches

One of Israel’s largest health maintenance organizations is using artificial intelligence to help identify which of the 2.4 million people it covers are most at risk of severe covid-19 complications. Once identified, individuals are put on a fast track for testing. The AI was adapted from an existing system trained to identify people most at risk from the flu, using millions of records from Maccabi going back 27 years. To make its predictions, the system draws on a range of medical data, including a person’s age, BMI, health conditions such as heart disease or diabetes, and previous history of hospital admissions. The AI can trawl through a vast number of records and spot at-risk individuals who might have been missed otherwise. [Technology Review]

The Oxford scientists now say that with an emergency approval from regulators, the first few million doses of their vaccine could be available by September — at least several months ahead of any of the other announced efforts — if it proves to be effective. Now, they have received promising news suggesting that it might. Scientists at the National Institutes of Health’s Rocky Mountain Laboratory in Montana last month inoculated six rhesus macaque monkeys with single doses of the Oxford vaccine. The animals were then exposed to heavy quantities of the virus that is causing the pandemic — exposure that had consistently sickened other monkeys in the lab. But more than 28 days later all six were healthy, said Vincent Munster, the researcher who conducted the test. “The rhesus macaque is pretty much the closest thing we have to humans…” [NY Times]

A purified inactivated SARS-CoV-2 virus vaccine candidate (PiCoVacc) confers complete protection in non-human primates against SARS-CoV-2 strains circulating worldwide by eliciting potent humoral responses devoid of immunopathology [bioRxiv]

Preliminary results from a clinical trial of remdesivir, an experimental antiviral drug being tested for coronavirus, could come in as little as one to two weeks. Information leaked to STAT News suggested that coronavirus patients receiving remdesivir in a clinical trial were recovering quickly. But STAT’s report was based on a recorded discussion of the trial, and it offered few details.

A Chinese trial showed that the drug [remdesivir] had not been successful. The US firm behind the drug, Gilead Sciences, said the document had mischaracterised the study.

04 February 2020.— An efficient approach to drug discovery is to test whether the existing antiviral drugs are effective in treating related viral infections. The 2019-nCoV [subsequently named SARS-CoV-2] belongs to Betacoronavirus which also contains SARS-CoV and Middle East respiratory syndrome CoV (MERS-CoV). Several drugs, such as ribavirin, interferon, lopinavir-ritonavir, corticosteroids, have been used in patients with SARS or MERS, although the efficacy of some drugs remains controversial.3 In this study, we evaluated the antiviral efficiency of five FAD-approved drugs including ribavirin, penciclovir, nitazoxanide, nafamostat, chloroquine and two well-known broad-spectrum antiviral drugs remdesivir (GS-5734) and favipiravir (T-705) against a clinical isolate of 2019-nCoV in vitro. […] Our findings reveal that remdesivir and chloroquine are highly effective in the control of 2019-nCoV infection in vitro. [Cell research]

While we will run very big budget deficits over the next couple of years, they will do little if any harm. […] The government will be able to borrow that money at incredibly low interest rates. In fact, real interest rates — rates on government bonds protected against inflation — are negative. So the burden of the additional debt as measured by the rise in federal interest payments will be negligible. [Paul Krugman]

Drive-in movies are proving popular in a pandemic

“By sharing your message with us using #MayThe4th, you agree to our use of the message and your account name in all media and our terms of use here: disneytermsofuse.com.”

this will be our year (The World vs. SARS-Cov-2) [Audio]

We show case and death counts had significantly lower growth rates at higher temperatures (>14 °C) when aligned for stage in the epidemic. We show irradiance and in particular solar zenith angle in combination with cloudopacity explain COVID-19 morbidity and mortality growth better than temperature.

Healthy people in their 30s and 40s barely sick with covid-19 are dying from strokes

People are dying from coronavirus because we’re not fast enough at clinical research

we propose that reduced innate antiviral defenses coupled with exuberant inflammatory cytokine production are the defining and driving feature of COVID-19.

COVID-19 Superspreader Events in 28 Countries: Critical Patterns and Lessons

Modelling COVID-19 exit strategies for policy makers in the United Kingdom

Experts offer four benchmarks that can serve as a guide for cities and states, eliminating some of the guesswork. Hospitals in the state must be able to safely treat all patients requiring hospitalization, without resorting to crisis standards of care; the state needs to be able to at least test everyone who has symptoms; the state is able to conduct monitoring of confirmed cases and contacts; and there must be a sustained reduction in cases for at least 14 days.

There is “no evidence” that people who recover from COVID-19 and have antibodies are protected from a second infection. “People who assume that they are immune to a second infection because they have received a positive test result may ignore public health advice. The use of such certificates may therefore increase the risks of continued transmission.”

Covid Economics, Issue 9, 24 April 2020 (Covid-19 and the macroeconomic effects of costly disasters, Air passenger mobility, travel restrictions, and the transmission of the covid-19 pandemic between countries, A cost-benefit analysis of the Covid-19 disease…)

What economy class could look like after virus

Facebook gets rid of ‘pseudoscience’ ad-targeting category

How to spot a doctor before the invention of the stethoscope — Wee (urine flasks), wigs (doctors sported what was known as a full-bottomed wig, which was as identifiable as the long wigs of judges or the pigtailed ones of barristers today)…

Our models demonstrate that while social distancing measures clearly do flatten the curve, strategic reduction of contact can strongly increase their efficiency, introducing the possibility of allowing some social contact while keeping risks low. Limiting interaction to a few repeated contacts emerges as the most effective strategy.

More than 21 percent of around 1,300 people in New York City who were tested for coronavirus antibodies this week were found to have them […] possibly as many as 2.7 million […] It would mean that the fatality rate from the virus was relatively low, about 0.5 percent [more]

The challenges of antibody testing for Covid-19 — no tests to date have performed well

scientists say the true potential of the rapidly developed antibody tests is still unknown

Developing antibody tests for SARS-CoV-2

About a quarter of Covid-19 patients put on ventilators in New York’s largest health system died, study

As virus advances, doctors rethink rush to ventilate

Las Vegas Mayor Offers Up Her City to See How Many Die Without Social Distancing

The concept of herd immunity is a simple one. But achieving it? Not so much.

In Belgium, Canada, France, Ireland and Norway, the % of COVID-related deaths in care homes ranges from 49% to 64%

We present a case of COVID-19 with an initial medical presentation of keratoconjunctivitis, the first such reported case in North America. The patient’s primary symptom was a red eye with watery discharge, though she did have mild respiratory symptoms, without fever. A conjunctival swab of the affected eye was positive for the SAR-CoV-2 virus.

In this study, one-third of patients with COVID-19 had ocular abnormalities, which frequently occurred in patients with more severe COVID-19. Although there is a low prevalence of SARS-CoV-2 in tears, it is possible to transmit via the eyes.

Officials probe the threat of a coronavirus bioweapon

Former Labradoodle breeder tapped to lead U.S. pandemic task force

Texas Lt. Gov. Dan Patrick (R) on reopening state: ‘There are more important things than living’

Here’s how one security and tech-savvy reader got taken for more than $10,000 in an elaborate, weeks-long phone-based scam.

Amazon Scooped Up Data From Its Own Sellers to Launch Competing Products

Want to Find a Misinformed Public? Facebook’s Already Done It - While vowing to police COVID-19 misinformation on its platform, Facebook let advertisers target users interested in“pseudoscience”

COVID-19 is, in many ways, proving to be a disease of uncertainty. According to a new study from Italy, some 43 percent of people with the virus have no symptoms. Among those who do develop symptoms, it is common to feel sick in uncomfortable but familiar ways—congestion, fever, aches, and general malaise. Many people start to feel a little bit better. Then, for many, comes a dramatic tipping point. “Some people really fall off the cliff, and we don’t have good predictors of who it’s going to happen to,” Stephen Thomas, the chair of infectious diseases at Upstate University Hospital, told me. Those people will become short of breath, their heart racing and mind detached from reality. They experience organ failure and spend weeks in the ICU, if they survive at all. Meanwhile, many others simply keep feeling better and eventually totally recover. […] This degree of uncertainty has less to do with the virus itself than how our bodies respond to it. As Murphy puts it, when doctors see this sort of variation in disease severity, “that’s not the virus; that’s the host.” Since the beginning of the pandemic, people around the world have heard the message that older and chronically ill people are most likely to die from COVID-19. But that is far from a complete picture of who is at risk of life-threatening disease. Understanding exactly how and why some people get so sick while others feel almost nothing will be the key to treatment. […] The people who get the most severely sick from COVID-19 will sometimes be unpredictable, but in many cases, they will not. They will be the same people who get sick from most every other cause. Cytokines like IL-6 can be elevated by a single night of bad sleep. Over the course of a lifetime, the effects of daily and hourly stressors accumulate. Ultimately, people who are unable to take time off of work when sick—or who don’t have a comfortable and quiet home, or who lack access to good food and clean air—are likely to bear the burden of severe disease. [The Atlantic]

“We are running a medical study here in Miami-Dade, we’re trying to figure out exactly what is the penetration of COVID-19 here in Miami-Dade. Over last week we did a random sample of about 800 of people in Miami-Dade. And what we found is that 60% of those people tested positive to the antibody which means they had it or they have it now, and they have exhibited absolutely no symptoms in the last 14 days.” [Miami-Dade County Mayor Carlos Gimenez | The 11th Hour with Brian Williams]

French researchers to test nicotine patches on coronavirus patients

Saliva is more sensitive for SARS-CoV-2 detection in COVID-19 patients than nasopharyngeal swabs

Doctor groups are recommending testing and isolation for people who lose their ability to smell and taste, even if they have no other symptoms.

prevalence, intensity, and timing of an altered sense of smell or taste in patients with SARS-CoV-2 infections altered sense of smell or taste was reported by 130 patients (64.4%) among these 130 patients 45 (34.6%) also reported blocked nose. Other frequent symptoms were fatigue (68.3%), dry or productive cough (60.4%), and fever (55.5%).

The novel coronavirus appears to be causing sudden strokes in adults in their 30s and 40s who are not otherwise terribly ill, doctors reported Wednesday and Signs of blood thickening and clotting were being detected in different organs by doctors from different specialties

Facebook released a map showing the proportion of people who say they have experienced coronavirus symptoms in each state in the US.

COVID-19 antibody testing in L.A. County: You’re going to be testing a randomly selected group of roughly 1,000 people every few weeks for several months. Why?

At least two people who died in early and mid-February had contracted the novel coronavirus, health officials in California said Tuesday, signaling the virus may have spread — and been fatal — in the United States weeks earlier than previously thought.

On Jan. 15, at the international airport south of Seattle, a 35-year-old man returned from a visit to his family in the Wuhan region. He grabbed his luggage and booked a ride-share to his home north of the city. The next day, as he went back to his tech job east of Seattle, he felt the first signs of a cough — not a bad one, not enough to send him home. He attended a group lunch with colleagues that week at a seafood restaurant near his office. As his symptoms got worse, he went grocery shopping near his home. Days later, after the man became the first person in the United States to test positive for the coronavirus, teams from federal, state and local agencies descended to contain the case. Sixty-eight people — the ride-share driver at the airport, the lunchmates at the seafood restaurant, the other patients at the clinic where the man was first seen — were monitored for weeks. To everyone’s relief, none ever tested positive for the virus. But if the story ended there… […] A genetically similar version of the virus — directly linked to that first case in Washington — was identified across 14 other states, as far away as Connecticut and Maryland. It settled in other parts of the world, in Australia, Mexico, Iceland, Canada, the United Kingdom and Uruguay. It landed in the Pacific, on the Grand Princess cruise ship. The unique signature of the virus that reached America’s shores in Seattle now accounts for a quarter of all U.S. cases made public by genomic sequencers in the United States. […] Even as the path of the Washington State version of the virus was coursing eastward, new sparks from other strains were landing in New York, in the Midwest and in the South. And then they all began to intermingle. […] on Feb. 24, a teenager came into a clinic with what looked like the flu. The clinic was in Snohomish County, where the man who had traveled to China lived. […] Only later did they learn that the teenager had not had the flu, but the coronavirus. […] The case was consistent with being a direct descendant of the first U.S. case, from Wuhan. […] The teenager had not been in contact with the man who had traveled to Wuhan, so far as anyone knew. He had fallen ill long after that man was no longer contagious. […] This could only mean one thing: The virus had not been contained to the traveler from Wuhan and had been spreading for weeks. [NY Times]

America’s armed forces can do more to protect against future outbreaks. Here’s how.

The Subways Seeded the Massive Coronavirus Epidemic in New York City and the paper cites no evidence.

The Entire U.S. Box Office This Weekend Came From a Single Florida Drive-in Theater

The [European Union] funds were distributed under a formula that sent far more to Hungary and Poland than to virus-ravaged Spain or Italy.

IKEA Released Its Swedish Meatball Recipe

Best ways of cooking veggies for maximum immunity boosting, and more

a mutation in the ABCC11 gene could explain why a large fraction of the population in the Far East lack body odour formation.

Flaw in iPhone, iPads may have allowed hackers to steal data for years

Air pollution may be ‘key contributor’ to Covid-19 deaths. Research shows almost 80% of deaths across four countries were in most polluted regions.

We found that when the person said “stay healthy,” numerous droplets ranging from 20 to 500 μm were generated

Parents name their baby ‘Sanitiser’

Out of Spain’s 40,000 confirmed coronavirus cases, 5,400 — nearly 14 percent — are medical professionals. In France, the public hospital system in Paris has tallied 490 infected staff members, a small but growing proportion of the system’s 100,000 or so employees.

France: By 11 May, when interventions are scheduled to be eased, we project 3.7 million (range: 2.3-6.7) people, 5.7% of the population, will have been infected. Population immunity appears insufficient to avoid a second wave if all control measures are released at the end of the lockdown.

Swedish data again - hospitalisations slowing down without full lockdown. Though definitely worse than other nearby countries who reacted more aggressively eg Norway

predictions [for Stockholm] show that the peak of infections appear in mid-April and infections start settling in May.

Testicles may make men more vulnerable to coronavirus

The duration of SARS-CoV-2 is significantly longer in stool samples than in respiratory and serum samples, highlighting the need to strengthen the management of stool samples in the prevention and control of the epidemic, and the virus persists longer with higher load and peaks later in the respiratory tissue of patients with severe disease.

More US labs could be providing tests for coronavirus (Nearly 1,600 said that they had the main tool needed to run tests, 130 are running tests)

Stock prices are not reflecting the value of companies and the S&P 500 could fall hard and fast, in a miniature version of Monday’s oil rout (when WTI crude futures fell from $17.85 a barrel to -$37.63) after a 25% rally since March 23.

Can the coronavirus be spread through farts?

we did not find compelling evidence that women are particularly inclined to wear red or pink during peak fertility, even on relatively cold days.

when experiencing the love condition, the temperature of the nasal tip of the subjects increased

Bilingualism Affords No General Cognitive Advantages

New Zealand isn’t just flattening the curve. It’s squashing it. It took only 10 days for signs that the approach here — “elimination” rather than the “containment” goal of the United States and other Western countries — is working. […] The health minister was caught mountain biking and taking his family to the beach. He was publicly chastised by Ardern, who said she would have fired him if it weren’t disruptive to the crisis response. […] “Other countries have had a gradual ramp-up, but our approach is exactly the opposite,” he said. While other Western countries have tried to slow the disease and “flatten the curve,” New Zealand has tried to stamp it out entirely. [Washington Post | The Conversation

Carl T. Bergstrom: letting the epidemic go through to herd immunity is worse than it sounds and Some nations may simply lack the economic resources, technological capacity, and political will to contain the virus until a vaccine can be developed. Should this happen, I think it is important to consider how more modest control efforts could yield major benefits.

In January, at a restaurant in Guangzhou, China, one diner infected with the novel coronavirus but not yet feeling sick appeared to have spread the disease to nine other people. One of the restaurant’s air-conditioners apparently blew the virus particles around the dining room. […] There were 73 other diners who ate that day on the same floor of the five-story restaurant, and the good news is they did not become sick. Neither did the eight employees who were working on the floor at the time. All of the people who became sick at the restaurant in China were either at the same table as the infected person or at one of two neighboring tables. The fact that people farther away remained healthy is a hopeful hint that the coronavirus is primarily transmitted through larger respiratory droplets, which fall out of the air more quickly than smaller droplets known as aerosols, which can float for hours. [NY Times]

Up-to-date values for R_t in US, a key measure of how fast the virus is growing.

There’s no guarantee, experts say, that a fully effective COVID-19 vaccine is possible. There’s never been a vaccine for a member of this family of viruses, and even if one is found for COVID-19, it may be imperfect — like the flu shot. [NY mag]

Unusual tactics to fight Covid-19 from around the world (gender-based lockdowns, weekend-only lockdowns…)

267 million Facebook profiles sold for $600 on the dark web

Experts say vast deserts, absence of life, may indicate Mars was once run by conservatives

Suppression of COVID-19 outbreak in the municipality of Vo, Italy (43.2% of the confirmed SARS-CoV-2 infections detected were asymptomatic)

The fact that an infected child did not transmit the disease despite close interactions within schools suggests potential different transmission dynamics in children.

COVID-19 Outbreak Associated with Air Conditioning in Restaurant, Guangzhou, China, 2020

Is the Virus on My Clothes? My Shoes? My Hair? My Newspaper? (You’ll feel better after reading this.)

The Pentagon has extended its freeze on domestic and international movement of troops through June 30 due to the coronavirus crisis. The freeze was originally set to expire on May 11.

Internet icons Jim Clark and Tom Jermoluk (past founders of Netscape, Silicon Graphics and @Home Network) launched a solution that eliminates all passwords.

Possible Dinosaur DNA Has Been Found

We travel around Australia taking photos of Chinese restaurants in suburban regional and rural areas.

Without a vaccine, the virus is expected to circulate for years, and the death tally will rise over time. […] Only when tens of thousands of antibody tests are done will we know how many silent carriers there may be in the United States. The C.D.C. has suggested it might be 25 percent of those who test positive. Researchers in Iceland said it might be double that. […] There may be good news buried in this inconsistency: The virus may also be mutating to cause fewer symptoms. In the movies, viruses become more deadly. In reality, they usually become less so, because asymptomatic strains reach more hosts. At the moment, however, we do not know exactly how transmissible or lethal the virus is. But refrigerated trucks parked outside hospitals tell us all we need to know: It is far worse than a bad flu season. […] If Americans pour back out in force, all will appear quiet for perhaps three weeks. Then the emergency rooms will get busy again. […] The virus will blossom every time too many hosts emerge and force another lockdown. […] The tighter the restrictions, experts say, the fewer the deaths and the longer the periods between lockdowns. […] Reopening requires declining cases for 14 days, the tracing of 90 percent of contacts, an end to health care worker infections, recuperation places for mild cases and many other hard-to-reach goals. […] Immunity will become a societal advantage. “Those with antibodies will be able to travel and work, and the rest will be discriminated against.” […] Soon the government will have to invent a way to certify who is truly immune. […] The California adult-film industry pioneered a similar idea a decade ago. Actors use a cellphone app to prove they have tested H.I.V. negative in the last 14 days, and producers can verify the information on a password-protected website. […] The next two years will proceed in fits and starts, experts said. As more immune people get back to work, more of the economy will recover. But if too many people get infected at once, new lockdowns will become inevitable. To avoid that, widespread testing will be imperative. [NY Times]

South Korea is trying to solve a mystery: why 163 people who recovered from coronavirus have retested positive […] the proportion of cases that retest positive is low, 2.1% […] For now, the most likely explanation of why people are retesting positive seems to be that the test is picking up remnants of the virus.

The dating industry was poised to take a hit amid the coronavirus outbreak as potential suitors are generally unable to meet in-person. Platform Match, which also owns Tinder and OkCupid, has seen stocks tumble 25%. But daters are turning to digital courtship through video chats and virtual activities as an alternative. [AXIOS]

Without widespread testing and surveillance, said Angela Rasmussen, a virologist at Columbia University in New York, “we won’t be able to quickly identify and isolate cases in which the patients are presymptomatic or asymptomatic, and thus community transmission could be re-established.”

There are, practically speaking, three paths out of the coronavirus crisis, to a way of life that resembles the one interrupted by COVID-19. The first is a vaccine. The second is effective treatment for the sick — not just effective at the margin, but so effective that catching the disease becomes a considerably less worrisome prospect for even those with comorbidities. The third is through herd immunity, when enough of the population has acquired COVID-19 antibodies that even with a return to “normal” life, there wouldn’t be enough opportunities for disease transmission for the virus to continue circulating through the population. You have probably heard quite a lot in the past few weeks about testing — in particular the need to deploy widespread testing and possibly what’s called “contact tracing” alongside it, to identify not just those who are sick but those they’ve been in contact with, as well. But a widespread testing regimen — or those “test and trace” programs — isn’t a path out of the pandemic, only out of lockdown. […] The most optimistic projection for vaccines is that they begin to be available this fall; other reputable estimates suggest between one and two years from now. [NY mag ]

On 4/3-4/4, 2020, we tested county residents for antibodies to SARS-CoV-2 using a lateral flow immunoassay. […] the population prevalence of COVID-19 in Santa Clara ranged from 2.49% (95CI 1.80-3.17%) to 4.16% (2.58-5.70%). […] The population prevalence of SARS-CoV-2 antibodies in Santa Clara County implies that the infection is much more widespread than indicated by the number of confirmed cases. [medRxiv]

Seattle: We estimate that the average population prevalence between March 23 and April 9 was 0.24% [95% CI 0.05% - 0.75%]. [PDF]

How does coronavirus kill? Clinicians trace a ferocious rampage through the body, from brain to toes

world’s biggest trial of drug to treat Covid-19 begins in UK (over 5,000 test subjects)

Our study shows that non-pharmaceutical interventions (including border restrictions, quarantine and isolation, distancing, and changes in population behaviour) were associated with reduced transmission of COVID-19 in Hong Kong, and are also likely to have substantially reduced influenza transmission in early February, 2020. [The Lancet]

Nearly half of the roughly 2,300 sailors from France’s Charles de Gaulle aircraft carrier group have tested positive for the coronavirus [To compare with: “The Diamond Princess cruise ship represented the worst-case scenario in terms of disease spread … only 20% were infected.” previously posted here]

Epidemiologists still don’t know the worldwide death rate for Covid-19

The “case fatality rate” of covid-19 varies wildly from country to country and even within nations from week to week.

One in five people globally could be at increased risk of severe COVID-19 disease through underlying health conditions

China revises its figures in Wuhan, adding 50 percent more deaths

Chinese officials on Friday said that the world’s second-largest economy shrank 6.8 percent in the first three months of the year compared with a year ago, ending a streak of untrammeled growth that survived the Tiananmen Square crackdown, the SARS epidemic and even the global financial crisis. The data reflects China’s drastic efforts to stamp out the coronavirus, which included shutting down most factories and offices in January and February as the outbreak sickened tens of thousands of people. The stark numbers make clear how monumental the challenge of getting the global economy back on its feet will be. Since

Wuhan’s 11 Million People Are Free to Dine Out. But They Aren’t.

DeRisi soon realized that he had stumbled onto a snake pandemic whose origin remained entirely uninvestigated. He ordered up some dead snakes so that he might play around with their genome in the same way that, back in 2003, he’d analyzed human genomes after people were killed by a mysterious new coronavirus that had surfaced in Hong Kong. (SARS, the new virus was being called.) To work the same magic on snakes that he did on humans — that is, to separate the genetic material that was “python” from everything else, he needed to know the python’s genome. “Who founded the Python Genome Project?” says DeRisi. “No one!” And so DeRisi took some of his graduate students to the San Francisco aquarium, extracted the blood of one of its snakes, and began what amounted to the Snake Genome project. Once he was done, he was able to take the genetic material of an infected snake, eliminate everything that was “snake,” and thus isolate what wasn’t snake: the virus. “It was actually an ancient ancestor of Ebola,” says DeRisi. “Dinosaurs had this same virus.” […] DeRisi is now the co-president of the Chan Zuckerberg Biohub, a nonprofit organization created a few years ago with a $600 million gift from the Facebook Inc. founder Mark Zuckerberg and his physician wife, Priscilla Chan. […] On March 12, DeRisi decided to turn the Biohub into a coronavirus testing lab. […] Eight days after the 200 volunteers started building the new UCSF testing lab, the Biohub was up and running. Since March 20, it’s been able to process 2,500 tests a day, at no cost. Quest Diagnostics, one of the biggest diagnostic labs in the country, was saying that if you sent them a test, it would take them a week to get back to you with an answer, along with their bill. In just one day more than it took Quest to process a single test, DeRisi built an entire lab that could process 2,500 of them. A day. For free. [Bloomberg ]

A Chicago hospital treating severe Covid-19 patients with Gilead Sciences’ antiviral medicine remdesivir in a closely watched clinical trial is seeing rapid recoveries in fever and respiratory symptoms, with nearly all patients discharged in less than a week, STAT has learned. [STAT]

More than 900 staffers in NYC’s public hospitals have tested positive for COVID-19

By late March, more than 54 doctors in Italy had already died, and in the Lombardy region of northern Italy, one of the worst hit regions in the world, 20% of the healthcare workforce have become confirmed cases. Now, in the United States, as large numbers of healthcare professionals are getting diagnosed with COVID-19 in Boston, New York, and other hotspot cities, young doctors are writing their wills and making provisional funeral plans. […] Because healthcare workers are exposed to the sickest patients—often without access to the proper protective equipment—the heavy viral load may be overwhelming even young clinicians’ ability to mount a sufficient immune response to counter the infection. [Fast Company]

Thailand is now reporting the first fatal case of coronavirus that was transmitted from a deceased patient to a medical examiner. [NY mag]

Home outbreaks were the dominant category (254 of 318 outbreaks; 79.9%), followed by transport (108; 34.0%; note that many outbreaks involved more than one venue category). Most home outbreaks involved three to five cases. We identified only a single outbreak in an outdoor environment, which involved two cases. Conclusions: All identified outbreaks of three or more cases occurred in an indoor environment, which confirms that sharing indoor space is a major SARS-CoV-2 infection risk. [medRxiv]

The Coronavirus Is Mutating. What Does That Mean for a Vaccine?

NRDD counts 115 (!) vaccine programs, of which 37 are unconfirmed (no further information available on them) and 78 are definitely real. Of those 78, five of them are in the clinic, although that number will be climbing rapidly. […] Pfizer and others have already said that they’re going to be working on production even before the efficacy data come in, which needless to say is not the usual business practice. I think we’ll get vaccine efficacy, one way or another, although it sure won’t be characterized as thoroughly as it normally would. And I think we’re already agreeing to cut corners on safety, whether anyone says so in as many words or not. But producing the vaccine on scale could be a bigger issue yet, and as the process goes on, that’s where I would keep an eye out for trouble. [Science]

Doctors are finding that placing the sickest coronavirus patients on their stomachs — called prone positioning — helps increase the amount of oxygen that’s getting to their lungs.

Severe economic and social shutdowns are effective in stopping the COVID-19 epidemic. But the economic and social pain is significant, and herd immunity is not being built. Exit strategies should aim at protecting those most vulnerable, while letting everyone else get back to work. [JP Morgan]

Here we propose an alternating lock-down strategy, in which at every instance, half of the population remains under lock-down while the other half continues to be active, maintaining a routine of weekly succession between activity and lock-down. [arXiv]

The data clearly suggest that the spread had been trending down significantly even before the initial lockdown.

A Workable Strategy for Covid-19 TestingThis paper argues that daily ‘universal random testing’, as recently proposed by Paul Romer, is not likely to be an effective tool for reducing the spread of Covid-19 and resuming economic activity. We find that more than 21% of the population would need to be tested every day to reduce the Covid-19 reproduction rate (R’) to 0.75, as opposed to 7% as argued by Romer.

U.K. Paid $20 Million for New Coronavirus Tests. They Didn’t Work.

My rough back-of-envelope calcs. suggest that relatively flat decline in deaths in Italy post-peak implies that strict social restrictions put in place there a month ago only reduced R to 0.85-0.9. Is this right? Seems like v. bad sign for keeping R<1 while relaxing restrictions. [...] I get slightly better estimates for Spain, more in the 0.8-0.85 range. [ Pat Bayer]

Why some younger people are getting better, while others are dying of covid-19 [Washington Post podcast]

Many aren’t insured, so testing and treatment would be prohibitively expensive, even if it were available. Or suppose they have gig economy jobs, such as Instacart delivery. What good would it do them to be told they were exposed? They know they’re at high risk. They need the work, otherwise they would have quit already. And if they really were sick, why would they risk their livelihood by volunteering the information to an app? [Bloomberg]

…“immunity passports” that would certify that a person has contracted the virus, recovered, and now has the antibodies required to be immune. The concept has its issues—but already, there’s an app for that. Bizagi, a UK-based tech company whose normal business is helping companies like Adidas and Occidental Petroleum digitize their operations, today released “CoronaPass,” an app that will use an encrypted database to store information about users’ immune status, based on antibody test results provided by the user’s hospital or other healthcare provider. [Quartz]

A contact-tracing app could help stop the coronavirus pandemic, but 80% of current smartphone owners would need to use it

Contact tracing has helped Asian countries like South Korea and Singapore contain the spread of the virus, but their systems rely on digital surveillance, using patients’ digital footprints to alert potential contacts, an intrusion that many Americans would not accept. Massachusetts is building its response around an old-school, labor-intensive method: people. Lots of them. Related: How do we reopen the country safely | audio [Washington Post podcast]

Meat processing plants are closing due to covid-19 outbreaks. Beef shortfalls may follow.

A zoo director in northern Germany has even admitted that some animals might soon have to be fed to others, if the zoo is to survive. “We’ve listed the animals we’ll have to slaughter first.” [BBC]

New York Streets Are Nearly Empty, but Speeding Tickets Have Doubled

As many New Yorkers began to stay away from work, school and restaurants, city sanitation workers picked up more household trash last month than they did the previous March, statistics show — except, primarily, in parts of Manhattan. Trash experts say the light trash loads in neighborhoods that include the Upper East Side, Upper West Side and East Village could reflect residents departing those areas as coronavirus spread. [The City ]

It’s not uncommon for the consulting firm McKinsey & Company — an agency that once functioned in the background of the world economy and that is now prone to intense scrutiny — to play both sides of the coin. […] As President Trump attacks Beijing, a frequent McKinsey client, for downplaying the spread of COVID-19 in the initial days of the outbreak, the White House is also employing the firm as part of its coronavirus response. Apparently, the firm isn’t afraid of getting in the middle of domestic tiffs either. According to CNBC, Governor Cuomo has hired McKinsey consultants to create a science-intensive plan for how to reopen the economies of seven northeastern states while minimizing the risk of spreading the virus. Sources with knowledge of the deal told the outlet that “as part of Cuomo’s effort, McKinsey & Co. is producing models on testing, infections and other key data points that will underpin decisions on how and when to reopen the region’s economy.” An adviser to New Jersey governor Phil Murphy said the goal is to “Trump-proof” the plan. [NY Mag]

Jeff Bezos has grown his fortune by a further $24 billion so far during the coronavirus pandemic

Hackers Are Selling a Critical Zoom Zero-Day Exploit for $500,000

Invite a llama or goat to your next corporate Zoom meeting or video call for under $100

Hastings Contemporary museum in England is offering virtual tours using a telepresence robot

toilet roll cakes keep Finnish baker in business

The world has come into this moment with divisions among its great powers and incompetence at the highest levels of government of terrifying proportions. We will pass through this, but into what? As recently as January, the IMF had no idea of what was about to hit, partly because Chinese officials had failed to inform one another, let alone the rest of the world. Now we are in the middle of a pandemic with vast consequences. But much remains unclear. One important uncertainty is how myopic leaders will respond to this global threat. [Financial Times]

The team at the Harvard School of Public Health used what’s known about Covid-19 and other coronaviruses to create possible scenarios of the current pandemic. “Intermittent distancing may be required into 2022 unless critical care capacity is increased substantially or a treatment or vaccine becomes available,” they wrote in their report. “Even in the event of apparent elimination, SARS-CoV-2 surveillance should be maintained since a resurgence in contagion could be possible as late as 2024.” [CNN]

If we just reopen there will be a second wave, or an endless half open economy. Public health — lots of testing, tracing, isolating — allows you to keep R0 low when there are relatively few cases without shutting down the economy. [John Cochrane]

Understanding the current status of the human herd, however, is harder than it looks. Current tests for SARS-CoV2 are exclusively measures of the viral nucleic acid, exploiting the exquisite sensitivity and specificity of PCR-based amplification strategies. This gives a clear indication of current (or very recent) infection, but it tells us nothing about the cumulative number of people exposed, nor the degree or nature of their immune response to the virus. Added to that, most countries have adopted a testing strategy focused on people with symptoms, giving us a relatively poor understanding of the degree of spread among people without symptoms. If there has been extensive spread of SARS-CoV2 in people who experienced no symptoms, then the fraction of the population with protective immunity may be much higher than predicted from nucleic acid testing among those with symptoms. [Drug Baron]

Immunity is a spectrum. Some viruses result in life-long protection, such as those that cause chickenpox and measles. On the other end of that spectrum, human immunodeficiency virus, or HIV, doesn’t usually provide any protective shield. When it comes to SARS-CoV-2, the virus that causes Covid-19, little is known yet about the body’s immune response to an infection, said George Rutherford, the head of infectious disease and global epidemiology at the University of California San Francisco. “That’s something that’s going to take a while to figure out.” […] Studies of SARS and MERS, which are closely related to SARS-CoV-2, have suggested limits to the body’s immune response. One 2007 report on SARS demonstrated that its antibodies dissipated after an average of two years, making patients potentially vulnerable to reinfection. A study of MERS found antibodies tended to stick around for a bit longer, but not in everyone. And neither study demonstrated whether the presence of antibodies was protection against re-infection. [Bloomberg]

In recent weeks, Covid-19 has rapidly spread throughout New York City. The obstetrical population presents a unique challenge during this pandemic, since these patients have multiple interactions with the health care system and eventually most are admitted to the hospital for delivery. We first diagnosed a case of Covid-19 in an obstetrical patient on March 13, 2020, and we previously reported our early experience with Covid-19 in pregnant women, including two initially asymptomatic women in whom symptoms developed and who tested positive for SARS-CoV-2, the virus that causes Covid-19, after delivery. After these two cases were identified, we implemented universal testing with nasopharyngeal swabs and a quantitative polymerase-chain-reaction test to detect SARS-CoV-2 infection in women who were admitted for delivery. Between March 22 and April 4, 2020, a total of 215 pregnant women delivered infants at the New York–Presbyterian Allen Hospital and Columbia University Irving Medical Center . All the women were screened on admission for symptoms of Covid-19. Four women (1.9%) had fever or other symptoms of Covid-19 on admission, and all 4 women tested positive for SARS-CoV-2. Of the 211 women without symptoms, all were afebrile on admission. Nasopharyngeal swabs were obtained from 210 of the 211 women (99.5%) who did not have symptoms of Covid-19; of these women, 29 (13.7%) were positive for SARS-CoV-2. [The New England Journal of Medicine]

As the coronavirus tears through the country, scientists are asking: Are some people more infectious than others? Are there superspreaders, people who seem to just spew out virus, making them especially likely to infect others? It seems that the answer is yes. […] Superspreading also played important roles in outbreaks of two other coronaviruses, SARS and MERS. “The MERS-CoV outbreak in South Korea was driven primarily by three infected individuals, and approximately 75 percent of cases can be traced back to three superspreaders who have each infected a disproportionately high number of contacts,” wrote George F. Gao, an immunologist and virologist […] The outbreak in South Korea began in 2015 when a 68-year-old man became infected with MERS during travel to the Middle East. He returned to South Korea where he directly infected 29 people, two of whom infected 106 people. The total number of cases in South Korea at that time was 166 — that superspreading event accounted for most of the outbreak. [NY Times]

Coronavirus 10 times more deadly than swine flu, says WHO

70 coronavirus vaccines in development, 3 candidates already undergoing human trials: WHO

Pharmacologic Treatments for Coronavirus Disease 2019 (No therapies have been shown effective to date)

As India’s Covid-19 cases count crossed 9,300 Monday, the Indian Council of Medical Research (ICMR) issued an advisory to begin “pool testing” of samples to increase the number of tests. Pool testing involves up to five samples in one go, rather than one at a time. If a pool comes up positive, each sample will be tested individually. [The Print]

Diagnostic testing to identify persons infected with severe acute respiratory syndrome–related coronavirus-2 (SARS–CoV-2) infection is central to control the global pandemic of COVID-19 that began in late 2019. In a few countries, the use of diagnostic testing on a massive scale has been a cornerstone of successful containment strategies. In contrast, the United States, hampered by limited testing capacity, has prioritized testing for specific groups of persons. Here, the authors review the current array of tests for SARS–CoV-2, highlight gaps in current diagnostic capacity, and propose potential solutions. [Annals of Internal Medecine]

UK app to track coronavirus spread to be launched

Orbital Insight, a California-based Big Data company that uses satellites, drones, balloons and cell phone geolocation data to track what’s happening on Earth, has seen inquiries about monitoring food supplies double in the past two months, according to James Crawford, founder and chief executive officer of the company. […] Orbital customers have been asking for data such as when cargo ships leave ports, when plants close, and the number of passengers traveling through airports. As infections continue to spike, clients in recent weeks began concentrating on tracking grocers, wholesalers, and distribution centers to monitor everything from food supplies to the production of medical supplies at specific factories, Crawford said. [Bloomberg]

Amazon fired two tech workers after they spoke out publicly against warehouse conditions during the coronavirus pandemic.

Over 500,000 Zoom accounts sold on hacker forums, the dark web

The Deleuze Seminars website is publishing English translations of the seminar lectures given by the French philosopher Gilles Deleuze (1925-1995)  at the University of Paris between 1971 and 1987. (via S/FJ)

Nudists warned by police to cover up their mouths for coronavirus

Coronavirus could attack immune system like HIV by targeting protective cells, warn scientists

The virus seems to have binary properties: not very contageous under most circumstances, but highly contagious in others.

Three novel alphacoronaviruses and three novel betacoronaviruses were detected for the first time in bats in Myanmar. Ongoing land use change remains a prominent driver of zoonotic disease emergence in Myanmar, bringing humans into ever closer contact with wildlife, and justifying continued surveillance and vigilance at broad scales.

What is required to prevent a second major outbreak of SARS-CoV-2 upon lifting the quarantine of Wuhan city, China [PDF | Cell.com]

Study suggests extending school and workplace closures in Wuhan until April, rather than March, would likely delay a second wave of cases until later in the year, relieving pressure on health services [LSHTM]

Changes in sleep pattern, sense of time, and digital media use during COVID-19 lockdown in Italy

Italian mayor uses drones to tell people to stay home under coronavirus lockdown

Usually, a mortgage company can withstand a few borrowers failing to make payments, but the breadth of the coronavirus pandemic has sparked industry estimates of between 25 and 50 percent of borrowers being unable to pay. [Politico]

The stimulus allows the Trump administration to loan $349 billion to small businesses without naming the companies receiving the loans. [Washington Post]

If you think people were upset about bailing out banks where the CEOs were making $50m a year, how are they going to feel about bailing out private equity firms where the CEOs make $500m a year? [Financial Times]

Amazon and Walmart are hiring a combined 250,000 workers to keep up with demand

How the Virus Transformed the Way Americans Spend Their Money

Benefits of exercise on metabolism: more profound than previously reported This reinforces the mandate for exercise as a critical part of programmes to prevent cardiovascular disease.

The present findings generate the hypothesis that moderate total meat consumption and notably, red meat may be more beneficial to prevent depressed mood and in turn hard cardiovascular disease endpoints.

Eat at Jeff Burger

Children with heavy exposure to screens exhibit similar social skills trajectories compared to children with little exposure to screens. There is a notable exception—social skills are lower for children who access online gaming and social networking many times a day.

Research indicates that women with tattoos are evaluated more negatively than women without tattoos on numerous qualities. Further, men perceive better chances for sexual success with tattooed women than those without visible tattoos. […] Among tattooed women alone, several personality and tattooing variables predicted sexual openness. [Sexuality & Culture]

This Man Owns The World’s Most Advanced Private Air Force

The new normal, Fauci said, will include “compulsive hand-washing and the other is the end of handshaking.”

We do not know how lethal it is. We do not know the effect of seasonality and climate on its spread. We do not understand the age skew of health outcomes, since the disparities between elderly patients and young ones vary wildly country to country. We do not know, for sure, whether those who have survived it have long-lasting immunity, short-lasting immunity, or why, in a few cases, at least, survivors seem to have no antibodies to the disease at all. We do not know how to treat it, at least not very well, with some doctors suggesting in recent days that the conventional use of ventilators on end-stage COVID-19 patients may be ineffective at best, and possibly even damaging. […] An Economist analysis looked at the unusual spike of doctor visits arising from “flu-like symptoms” — atypical for this time of year — and suggested that COVID-19 may have spread as much as 200 times as fast as widely understood. This would amount to a total rewriting of our understanding of the disease; as the authors suggest, it would mean the disease was only about as lethal as the flu, though very much easier to catch. [NY mag]

why you should not walk/run/bike close to each other

What the Trump administration should’ve done in late January was to mobilize the entire federal government. That it still hasn’t done so is both inexplicable and shockingz

In mid-May, the companies will update their operating system to support the contact-sharing technique and allow for contact-tracing apps. In the coming months, a further operating system update will allow the system to work without needing a specific app. [Axios]

I’ve read the plans to reopen the economy. There is no normal for the foreseeable future.

Daryn Parker, the vice president of CamSoda, said there had been a 37 percent increase in new model sign-ups this March, compared to last March. For the same period, Bella French, the co-founder and C.E.O. of ManyVids, another camming site, said that there was a 69 percent increase in new model sign-ups. […] But this growth isn’t always translating into more money for the models. […] “I’m meeting a whole bunch of people more frequently than I normally would, but there’s not much more money,” said Ms. Kane. […] Ms. Kane cams for 12 hours a day, almost every day of the year, she said, and only took two days off last year. Though this schedule is physically exhausting, she said it’s worth it. [NY Times]

Chinese Professional Baseball League team will have robot mannequins fill in as fans at games

The Best Hopes for a Coronavirus Drug

Researchers modelling the spread of the coronavirus emphasise the importance of avoiding busy indoor spaces

Why Does the Trump Administration Keep Seizing Hospitals’ Coronavirus Supplies?

Faced with Covid-19, Germany resisted better than the other major European countries. If the number of contaminations is very high, mortality is much lower than in Italy, Spain, or France. Is there a German model in the fight against coronavirus? [France Culture | Google Translate]

Italy working on coronavirus tracing app to help lockdown exit

Sweden has no mandatory quarantines and few limitations on free movement. Elementary schools remain open; malls, gyms and shopping streets are far from empty. […] even as provisional intensive care units –– and makeshift morgues –– have been set up in the Swedish capital, and the government is considering stricter measures, some sidewalk cafes are still bustling with life. […] There are indications that Sweden is experiencing a higher death toll than its neighbors. While the Scandinavian countries reported their first fatalities at roughly the same time, Sweden as of April 8 had 687 fatalities, Denmark 218 and Norway 93. In per capita terms, Sweden is faring clearly worse than Norway and increasingly worse than Denmark. […] There are now alarming reports that the virus has spread to one-third of nursing homes in Stockholm, which has resulted in rising fatalities. [Washington Post]

Greenland stays optimistic while bracing for a long fight against the coronavirus

From Dubai: Is self-isolation the ultimate Dopamine detox?

Wimbledon 2020 cancelation: “We’re fortunate to have the insurance”

Cats can become infected with the new coronavirus but dogs appear not to be vulnerable, according to a study published on Wednesday

Second-wave scenario planning

The virus seems to be most transmissible when it is stuck to much larger water or mucus droplets that come out of our mouths and noses when we cough, sneeze or talk, and a homemade mask can block those droplets. As the mask needs to be made of something you already have around the house, cotton seems to be a good choice. The CDC recommends two layers of tightly woven 100 percent cotton fabric, such as quilter’s material or bedsheets with a high thread count. [DIY masks | Washington Post]

Simple origami face shield can be folded from single sheet of plastic

Google Told Its Workers That They Can’t Use Zoom On Their Laptops Anymore

Zoom Accused of Misrepresenting Security Measures in New Lawsuit

Voleflix (Public-domain movies)

New emoji are being delayed by the coronavirus pandemic [117 new emojis for 2020]

Vogue Italia Printed a Blank White Cover

Zoo, an experimental, immersive, web-based 3D experience for an Atlanta-based creative agency

NYC Bike Messenger livestreams

shits getting real (The World vs. SARS-Cov-2) [playlist]

There’s a lot of good news mixed in with the bad. Here are some positive things we’ve learned in the last week

The next emerging infectious disease could easily be more contagious, more fatal, or both.
Dr Cassidy Nelson on the twelve best ways to stop the next pandemic (and limit COVID-19)

Exploratory analyses highlight a potential additional link between COVID-19 and suicidal behavior, suggesting that a portion of individuals may be intentionally exposing themselves to the virus with intent to kill themselves. [PsyArXiv]

An article published in the Journal of Family Violence in January 2020 found that between 62 and 72 percent of women (the only gender surveyed) have been stalked, and 60 to 63 percent have experienced technology-based abuse by an intimate partner. “Technology is not the only tactic; it is one of many,” said Erica Olsen. “Today’s technology offers new ways to perpetrate abuse, but the behaviors and the reasons for it are not new. Abusers want power and control over the other person, and this is just one more way to get that.” [Here’s how to record abuse without being discovered, safeguard your devices, and, ultimately, protect yourself.]

Wuhan’s 11 million residents will be able to leave only after receiving official authorization that they are healthy and haven’t recently been in contact with a coronavirus patient. To do so, the Chinese government is making use of its mandatory smartphone application that, along with other government surveillance, tracks the movement and health status of every person. [Washington Post]

People can now leave after presenting to the authorities a government-sanctioned phone app that indicates — based on their home addresses, recent travels and medical histories — whether they are contagion risks. Footage from state-run news outlets early Wednesday showed a rush of cars traveling through toll stations on the outskirts of Wuhan immediately after the restrictions were lifted. China’s national rail operator estimated that more than 55,000 people would leave Wuhan by train on Wednesday, according to a state-run broadcaster. Officials continue to urge everyone to stay at home as much as possible. Schools are still closed. […] In recent days, more shops have reopened, often setting up street-front counters so that customers can buy vegetables, alcohol, cigarettes and other goods without entering. In parks along the Yangtze River, growing numbers of families have ventured out to take in the sunshine and fresh air. Older residents have started congregating again in small groups to chat or play rounds of Chinese chess. Children are a rarer sight, and always appear to be under the wary watch of parents. Public buses and the subway system have restarted, although they often seem to have few passengers. Mountains of cardboard boxes have sprouted up outside apartment complexes as online shopping picks up. […] Across Wuhan, nearly 94 percent of businesses — almost 11,000 of them in total — have resumed operations, said Hu Yabo, the city’s deputy mayor, at a recent news briefing. For major industrial enterprises, the rate exceeded 97 percent. For service companies, it was 93 percent. [NY Times]

And how long can democracies limit people’s freedoms to the degree we are currently experiencing? Germany hasn’t yet been completely shut down, but Italy, Spain and France have. For what length of time can the people of those countries be prohibited from going out? […] “To ensure that testing becomes quicker and more efficient,” the study reads, “the use of Big Data and location tracking is unavoidable on the long term.” If this model is followed, around a million people in Germany would become infected and only around 12,000 would die, an optimistic scenario given the current situation. It would require keeping strict measures in place for two months. But because only a small share of the population would then be immune to the virus, “extreme vigilance would have to be maintained,” the study points out. [Spiegel]

Like governments around the world, the United States is struggling with the “coronavirus trilemma”: It wants to protect lives, ease social isolation, and protect privacy and civil liberties, but it can do only two of those at the same time. In particular, and as South Korea’s successful management of the coronavirus shows, extensive surveillance may be the only way to control the outbreak while preserving some degree of normalcy for economic and social life. [Lawfare]

In the current COVID-19 pandemic, there have been official health recommendations of social distancing, thorough handwashing, and self-isolation to prevent the spread of the virus. However, compliance with these recommendations has been mixed. We suggest that non-compliance may be justified by one’s (mis)perception of their own COVID-19 risk.

Trump has a small personal financial interest in Sanofi, the French drugmaker that makes Plaquenil, the brand-name version of hydroxychloroquine.

Yale New Haven Hospital, where I work, has almost 300 people stricken with Covid-19, and the numbers keep rising — and yet we are not yet at capacity because of a marked decline in our usual types of patients. In more normal times, we never have so many empty beds. Our hospital is usually so full that patients wait in gurneys along the walls of the emergency department for a bed to become available on the general wards or even in the intensive care unit. We send people home from the hospital as soon as possible so we can free up beds for those who are waiting. But the pandemic has caused a previously unimaginable shift in the demand for hospital services. […] What is striking is that many of the emergencies have disappeared. Heart attack and stroke teams, always poised to rush in and save lives, are mostly idle. This is not just at my hospital. My fellow cardiologists have shared with me that their cardiology consultations have shrunk, except those related to Covid-19. [Harlan M. Krumholz, M.D. | NY Times]

Viruses such as SARS-CoV-2 and Influenza are lipophilic, enveloped viruses, and are relatively easy to inactivate by exposure to alcohols. […] We use 40 v/v% whisky or similar alcohol, dripping on a gauze, inhale the vapor slowly at room temperature. This method works well for the front part of the nasal cavity.[arXiv]

Coronavirus can infect cats — dogs, not so much

How Chinese Apps Handled Covid-19

More space between seats at restaurants, cinemas, sporting events and the like, meaning fewer people. Less vacation and business travel, coupled with more global government restrictions, at least until a vaccine is developed, cutting back consumer and business spending. Regulations forcing households and corporates to hold potentially three months of cash in emergency savings. A significant increase in the supply of government bonds, risking a debt crisis. […] As hard as coronavirus is going to hit the industrialized world, the impact on the developing world is going to be significantly more severe. [Axios]

A Rough Estimate of the 2020 US GDP Impact

New Research Links Air Pollution to Higher Coronavirus Death Rates (dangerous particles in air known as PM 2.5 were associated with higher death rates from the disease)

We re-analysed 640 throat swabs collected from patients in Wuhan with influenza-like-illness from 6 October 2019 to 21 January 2020 and found that 9 of the 640 throat swabs were positive for SARS-CoV-2 RNA by quantita- tive PCR, suggesting community transmission of SARS-CoV2 in Wuhan in early January 2020. [PDF | Nature Microbiology]

Fewer deaths in Veneto offer clues for fight against virus. […] Lombardy has a death rate of 17.6 per cent. Nearby Veneto’s stands at 5.6 per cent. While virologists caution that the percentage death rate is closely tied to the level of testing, they also attribute the gap to other factors, such as Veneto’s reluctance to hospitalise compared with its neighbour. […] Higher levels of testing and tracing in Veneto is the most widely cited explanation for why the region has managed to control its outbreak more effectively than its neighbours. […] Venetian doctors also cite the region’s expertise in infectious disease, something they trace back to its pioneering history dealing with viruses arriving in its port from the east. The word quarantine derives from quarantena, the Venetian word for “40 days”, or the amount of time ships arriving from plague-ridden destinations were isolated. [Financial Times]

On Friday April 3, the French Director General of Health, Jérôme Salomon, for the first time recognized that the wearing of a mask by the general public could have an interest. How did something that was deemed unnecessary for so long suddenly become useful? [France Culture | Google Translate]

How will we know when to reopen the country? […] Hospitals in the state must be able to safely treat all patients requiring hospitalization, without resorting to crisis standards of care. A state needs to be able to test at least everyone who has symptoms. The state is able to conduct monitoring of confirmed cases and contacts. There must be a sustained reduction in cases for at least 14 days. [NY Times]

Those who are hospitalized with coronavirus can expect to pay anywhere from $42,486 to $74,310 if they are uninsured or if they receive care that’s deemed out-of-network by their insurance company. For those with insurance who are using in-network providers, out-of-pocket costs will be a portion of $21,936 to $38,755, depending on the cost-sharing provisions of their health plan. [CNBC]

The coronavirus wiped out most major tech events. But CanSecWest still took place—with face masks, temperature checks, and an eerily quiet atmosphere.

There has been a 600% increase in images of people washing their hands, face and body. The AI tool also discovered a 200% increase of “cleanliness” related images and videos. These included touching faces, sneezing, coughing, drinking, smelling, tissues and cleaning. […] 8% drop in the use of travel imagery. [AdNews]

Panama is quarantining women and men on different days during its coronavirus lockdown

Around the world, seismologists are observing a lot less ambient seismic noise — meaning, the vibrations generated by cars, trains, buses and people going about their daily lives. And in the absence of that noise, Earth’s upper crust is moving just a little less. [CNN]

What NASA is doing to keep COVID-19 off the space station

Several dogs and cats have tested positive to COVID-19 virus following close contact with infected humans. Studies are underway to better understand the susceptibility of different animal species to the COVID-19 virus and to assess infection dynamics in susceptible animal species. Currently, there is no evidence to suggest that animals infected by humans are playing a role in the spread of COVID-19. Human outbreaks are driven by person to person contact. [World Organisation for Animal Health]

A tiger at the Bronx Zoo tests positive for the coronavirus, and other big cats there appear ill.

In some regions of the country, non-coronavirus deaths were rising at an alarming rate alongside confirmed COVID-19 deaths — the total death count was up as much as sixfold from previous years. Those deaths officially attributed to the coronavirus accounted for barely a quarter of the increase. […] How many “excess deaths” are patients who have COVID-19 but haven’t been diagnosed with it, and how many are patients with other illnesses who can’t get proper treatment in overwhelmed hospital systems? […] In Bergamo, a city northeast of Milan, about 20 percent of all family physicians have been infected. [NY mag]

30 million Americans could lose their private health insurance over the next few months

American Indians have the highest rates of diseases that make covid-19 more lethal. Conditions in Indian Country are ripe for a rapid spread of the coronavirus. Rates of infection among Navajos is a major concern.

Gates said he was picking the top seven vaccine candidates and building manufacturing capacity for them. “Even though we’ll end up picking at most two of them, we’re going to fund factories for all seven, just so that we don’t waste time in serially saying, ‘OK, which vaccine works?’ and then building the factory,” he said. [Business Insider]

This notebook tries to estimate how many actual cases of SARS-COV-2 infections there might be today and contrasts this with the number of confirmed cases known today

How Taiwan has kept the virus under control

Some countries’ first impulses are to cover up the spread of the disease. We look at a few of those efforts, plus some brutal methods of enforcing stay-at-home orders. [Slate]

Every day, millions of people around the world type their health symptoms into Google. We can use these searches to help detect unknown Covid-19 outbreaks, particularly in parts of the world with poor testing infrastructure. […] There is now strong evidence that anosmia, or loss of smell, is a symptom of Covid-19, with some estimates suggesting that 30-60 percent of people with the disease experience this symptom. In the United States, in the week ending this past Saturday, searches for “I can’t smell” were highest in New York, New Jersey, Louisiana, and Michigan — four of the states with the highest prevalence of Covid-19. […] Searches for “no puedo oler” (“I can’t smell”) are some 10 times higher per Google search in Ecuador than they are in Spain, even though Ecuador officially reports more than ten times fewer Covid-19 cases per capita than Spain does. Ecuadorians are also right near the top in searches for fever, chills and diarrhea. […] searches for “non sento odori” (“I can’t smell”) were elevated in Italy days before the symptom was reported in the news. […] The three searches most related to Covid-19 disease rates were not a surprise: loss of smell, fever and chills. The fifth and sixth searches weren’t much of a surprise either: nasal congestion and diarrhea, which have also received a lot of attention as Covid-19 symptoms. However, the fourth-place search was a surprise: eye pain, which has not garnered much attention as a possible symptom of the disease. Seth Stephens-Davidowitz | NY Times

Report showed 43,000 fewer health-care jobs in mid-March than in mid-February. Hospital employment was almost precisely flat between the two months, but dental offices reported 17,000 fewer workers and doctors’ offices had 12,000 fewer. Since about three times as many Americans work in doctors’ offices as in dentists’ offices, that’s an especially hard hit to dental employment, which makes sense: Most dental services are not emergencies, and dental work creates significant risk of exposure to coronavirus. […] “There are jobs that people decided wouldn’t be affected by coronavirus because they could be done remotely, but those jobs are dependent on people paying for those services.” All that job loss across the economy means less spending power in households and at businesses. And that may mean less business even for enterprises that can adjust to the stay-at-home orders and keep doing business. [NY mag]

Your grocery shelves might be empty now, but there are countless number of people (and machines) working to refill them.

trapped in an eternal honeymoon in the Maldives

Berlin’s drug dealers adapt to life under coronavirus lockdown [Finacial Times | unlocked]

This is for all the landlords out there. [Thanks Tim]

Do we really need to weigh lives against money? If so, how do you do it right? […] As human beings, we tend to see life as having almost infinite value, but it’s also worth remembering that money spent to save one life has an opportunity cost: It could have been spent in another fashion and—if spent more efficiently—saved even more lives. Resources are never unlimited, and without assessing the dollars-to-lives tradeoff, it’s likely that policymakers will fail to save as many lives as they otherwise could. […] Here’s where assigning a dollar value to life-extending benefits enters the equation. One common way to do this is by using the “value of a statistical life,” or VSL, which reflects what current citizens are willing to pay to reduce their own risk of death. (It’s usually estimated by looking at how much extra compensation workers in dangerous professions get paid.) Estimates of the VSL vary, but tend to average about $10 million for Americans. If we assume, for example, that the government’s response to Covid-19 prevents an enormous death toll of 2 million citizens, the value of all those prevented deaths could be as much as $20 trillion. […] Cost-benefit analysis can offer us a way to think about decisions, and put some boundaries around the likely outcomes. But even in simpler circumstances, it cannot always provide bright-line recommendations. And it can’t answer our deepest and most profound questions. In some cases, the calculus has to be driven not by a set of numbers, but by our values. […] Contrary to popular belief, deaths go down during economic downturns. […] Suicides tend to be low in wartime […] The economy took a hit during the 1918 influenza pandemic, but cities that intervened earlier and more aggressively fared better. [Politico]

It is hard to start a new business, and if all the businesses shut down then it will be hard to start all new ones when the lockdowns end. […] The U.S. government has announced that small businesses can apply to banks for loans to cover their payrolls, and that if they actually use the money to pay workers—if they don’t lay people off—then the government’s Small Business Administration will forgive the loans. […] It is all very smart and elegant but there is a problem, which is that banks are a little nervous about vetting companies for the government and might just decline to do it. (The government will also guarantee the loans, even the ones that aren’t forgiven, so the banks take no credit risk.) Banks are, precisely, in the business of vetting applications from local restaurants, examining their financial records and deciding how much money they need. The government, meanwhile, is best equipped to generate magical quantities of money. […] It is all very smart and elegant but there is a problem, which is that banks are a little nervous about vetting companies for the government and might just decline to do it. [Matt Levine | Bloomberg]

Rich countries try radical economic policies to counter covid-19. History suggests that the effects will be permanent. [Economist]

This virus does have the ability to transmit far easier than flu. It’s probably now about three times as infectious as flu. One of the [pieces of] information that we have pretty much confirmed now is that a significant number of individuals that are infected actually remain asymptomatic. That may be as many as 25%. […] Of those of us that get symptomatic, it appears that we’re shedding significant virus in our oropharyngeal compartment, probably up to 48 hours before we show symptoms. This helps explain how rapidly this virus continues to spread across the country, because we have asymptomatic transmitters and we have individuals who are transmitting 48 hours before they become symptomatic. […] This virus cannot go from person to person that easily. It needs us to be close. It needs us to be within 6 feet. If we just distance ourselves, this virus can’t sustain itself and it will go out. [Dr. Robert Redfield, CDC Director | NPR]

Inside the Coronavirus Genome
Viruses must hijack living cells to replicate and spread. When the coronavirus finds a suitable cell, it injects a strand of RNA that contains the entire coronavirus genome. The first sequence of RNA letters reads: auuaaagguuuauaccuucccagguaacaaaccaaccaacuuucgaucucuuguagaucuguucucuaaacgaacuuuaaaaucuguguggcugucacucggcugcaugcuuagugcacucacgcaguauaauuaauaacuaauuacugucguugacaggacacgaguaacucgucuaucuucugcaggcugcuuacgguuucguccguguugcagccgaucaucagcacaucuagguuucguccgggugugaccgaaagguaag

Two episodes from The Daily, NY Times podcast: The Race for the Vaccine and Why the U.S. Is Running Out of Medical Supplies

It’s theoretically possible that coronavirus could infect the region of the brain responsible for smell. […] “The pure smell sense would be if you can smell a particular substance that’s not stimulating other nerves. […] For example, Ammonia or cleaning solutions, those stimulate the trigeminal nerve, which is an irritant nerve. And so people will think, ‘Oh, I can smell Clorox, I can smell ammonia, which means I can smell.’ But no, that’s not correct. They’re not actually smelling, they’re using the trigeminal nerve.”

For the first time in history, most American adults carry an always-on geolocation device—their smartphone—on their person most of the time. Many popular smartphone apps passively transmit user location—via cellular, GPS, WiFi, or Bluetooth technology—to app companies at all hours of the day. […] These are rich datasets that public health officials and researchers are using to evaluate shelter-at-home compliance and model COVID-19 transmission speeds. For example, officials in Austria and Italy are already using anonymized location information from mobile phone company records to examine the efficacy of their COVID-19 lockdowns.  Similar analysis is underway in the United States. […] If most residents are spending 22 hours in one location except for brief visits to the grocery store and parks, that is a reliable sign that people are engaging in fairly strict social distancing behaviors […] Combining these data with reported infection and hospitalization rates will allow policymakers to analyze various jurisdictions and geographic areas based on a matrix of risk levels. [Mercatus]

No-Sew Pleated Face Mask with Handkerchief and Hair Tie

Cumulative counts of COVID-19 cases by U.S. state over time

A pilot wrote a coronavirus message in the sky [March 19]

Unsolicited Advice for Living in the End Times

‘Zoombombing’ is a federal offense that could result in imprisonment, prosecutors warn

unrelated:

Have Smartphones Destroyed a Generation?

The caption of this photo probably triggered one of the biggest edit wars in Wikipedia’s history.